Method and primers for detecting ASXL1 gene c. 1934dupG mutation site
A c.1934dupg, mutation site technology, applied in the field of life science and biology, can solve the problems of low abundance and singleness of non-specific amplification products, achieve the best amplification efficiency, simple operation, and improve amplification specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Primers for detecting the c.1934dupG mutation site of the ASXL1 gene, said primers include: forward and reverse amplification primers for amplifying the c.1934dupG mutation site of the ASXL1 gene, the base sequence of which is:
[0039] ASXL1-exon12-F: CCCAGTCAGTTAAAACTATTTTTCT
[0040] ASXL1-exon12-R: TTTCTCAGAGAAGGCAGGTCCTCT.
[0041] Further, the primers also include a pair of sequencing primers, the base sequence of which is:
[0042] ASXL1-exon12-S-F: CCCAGTCAGTTAAAACTATTTTTCT
[0043] ASXL1-exon12-S-R: TTTCTCAGAGAAGGCAGGTCCTCT.
[0044] A kit for detecting the c.1934dupG mutation site of ASXL1 gene, comprising: sample DNA extraction reagent; absolute ethanol; detection system PCR reaction solution; sequencing system reaction solution; positive control substance, negative control substance and blank control substance.
[0045] Detection system PCR reaction solution includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); forward and reverse amplificatio...
Embodiment 2
[0059] The operation process of the blood DNA extraction kit (Tiangen Biology):
[0060] (1) Genomic DNA extraction from blood
[0061] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed;
[0062] 2) Add 20 μl proteinase K solution and mix well;
[0063] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;
[0064] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;
[0065] 5) Add the solution and flocculent precipit...
Embodiment 3
[0091] Clinical samples were tested using the kit in Example 1.
[0092] Ten cases of anticoagulated blood samples from patients with acute myeloid leukemia (AML) were taken for inspection, and genomic DNA was extracted, reagents were prepared and tested according to the method described in Example 2.
[0093] Add 2 ul of the genomic DNA solution of each sample extracted according to the method described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative, and blank controls at the same time. Each sample is repeated twice, one positive control, one negative control, and one blank control. The detection time is 160 minutes.
[0094] The amplification products of the genomic DNA of each sample were sequenced twice by Sanger, and compared with the mutation of the c.1934dupG site of the ASXL1 gene, and the samples with inconsistent results will be sequenced for the third time. Finally, the prognosis is judged according to the sequencing res...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 