Method and primers for detecting ASXL1 gene c. 1934dupG mutation site

A c.1934dupg, mutation site technology, applied in the field of life science and biology, can solve the problems of low abundance and singleness of non-specific amplification products, achieve the best amplification efficiency, simple operation, and improve amplification specificity Effect

Inactive Publication Date: 2014-04-30
CHENGDU ADICON CLINICAL LAB
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Touch-down PCR amplification can ensure that the combination of the forward and reverse amplification primers and the sample DNA template occurs between the most complementary sequences. When the annealing temperature is reduced to the level where non-specific amplification occurs, the specific amplification product is At this time, there is already a geometric number of initial advantages, and the abundance is high. In the remaining amplification reactions, the specific amplification products compete with the non-specific amplification products, but due to the low abundance of non-specific amplification products , the specific amplification product is always preferentially amplified, resulting in a single dominant specific amplification product

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primers for detecting ASXL1 gene c. 1934dupG mutation site
  • Method and primers for detecting ASXL1 gene c. 1934dupG mutation site
  • Method and primers for detecting ASXL1 gene c. 1934dupG mutation site

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Primers for detecting the c.1934dupG mutation site of the ASXL1 gene, said primers include: forward and reverse amplification primers for amplifying the c.1934dupG mutation site of the ASXL1 gene, the base sequence of which is:

[0039] ASXL1-exon12-F: CCCAGTCAGTTAAAACTATTTTTCT

[0040] ASXL1-exon12-R: TTTCTCAGAGAAGGCAGGTCCTCT.

[0041] Further, the primers also include a pair of sequencing primers, the base sequence of which is:

[0042] ASXL1-exon12-S-F: CCCAGTCAGTTAAAACTATTTTTCT

[0043] ASXL1-exon12-S-R: TTTCTCAGAGAAGGCAGGTCCTCT.

[0044] A kit for detecting the c.1934dupG mutation site of ASXL1 gene, comprising: sample DNA extraction reagent; absolute ethanol; detection system PCR reaction solution; sequencing system reaction solution; positive control substance, negative control substance and blank control substance.

[0045] Detection system PCR reaction solution includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); forward and reverse amplificatio...

Embodiment 2

[0059] The operation process of the blood DNA extraction kit (Tiangen Biology):

[0060] (1) Genomic DNA extraction from blood

[0061] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed;

[0062] 2) Add 20 μl proteinase K solution and mix well;

[0063] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0064] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0065] 5) Add the solution and flocculent precipit...

Embodiment 3

[0091] Clinical samples were tested using the kit in Example 1.

[0092] Ten cases of anticoagulated blood samples from patients with acute myeloid leukemia (AML) were taken for inspection, and genomic DNA was extracted, reagents were prepared and tested according to the method described in Example 2.

[0093] Add 2 ul of the genomic DNA solution of each sample extracted according to the method described in Example 2 into the PCR reaction solution of the detection system. Do positive, negative, and blank controls at the same time. Each sample is repeated twice, one positive control, one negative control, and one blank control. The detection time is 160 minutes.

[0094] The amplification products of the genomic DNA of each sample were sequenced twice by Sanger, and compared with the mutation of the c.1934dupG site of the ASXL1 gene, and the samples with inconsistent results will be sequenced for the third time. Finally, the prognosis is judged according to the sequencing res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and primers for detecting an ASXL1 gene c. 1934dupG mutation site. The primers include forward and reverse amplification primers for amplifying the ASXL1 gene c. 1934dupG mutation site and a pair of sequencing primers. Through combining Touch-down PCR amplification and Sanger sequencing, the mutation situation of the ASXL1 gene c. 1934dupG site in a patient with acute myeloid leukemia can be accurately and specifically detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a method and primers for detecting the c.1934dupG mutation site of ASXL1 gene. Background technique [0002] Acute myeloid leukemia (AML) is a hematological malignancy characterized by changes in cell proliferation, differentiation, and apoptosis pathways due to accumulated acquired genetic changes in myeloid hematopoietic stem / progenitor cells. [0003] The ASXL1 gene encodes a member of the polycomb family of chromosomal junction proteins and is associated with epigenetic regulation of gene expression. The protein encoded by the ASXL1 gene contains a plant homology region and a nuclear receptor box region, and functions as a ligand-dependent retinoic acid receptor coactivator. This protein has been shown to exert direct action through a protein with histone acetyltransferase activity encoded by the NCOA1 gene or a histone demethylase encoded by the LSD1...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6869C12Q1/6886C12Q2600/156C12Q2535/101C12Q2531/113
Inventor李文静陈奕磊王淑一
OwnerCHENGDU ADICON CLINICAL LAB