Primer, method and kit for detecting ATRX (X-linked alpha thalassemia mental retardation syndrome) gene locus mutation
A technology for sequencing primers and genes, which is applied in the fields of life sciences and biology, can solve problems such as prolonging survival time, and achieve the effects of high detection difficulty, low cost and difficulty, and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The present invention will be further explained below in conjunction with specific embodiments and drawings. It should be noted that the conventional conditions and methods not described in the examples usually follow the methods routinely used by experimenters in the field: for example, the fourth edition of the "Comprehensive Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the steps and conditions recommended by the manufacturer.
[0036] A primer for detecting mutations in ATRX gene locus. The primer is designed for intron No. 7 101175C> T mutation sites, including:
[0037] A detection of ATRX gene 101175C> T-site mutation kit, including
[0038] (1) Blood DNA extraction reagent;
[0039] (2) PCR amplification reaction system reagents; including primers for amplification of ATRX gene mutation point sequence:
[0040] ATRX-F: CAGTGTCCTGGAGATTTTC
[0041] ATRX-R: ATTACCTACCTACATTGTTCAT;
[0042] (3) Sequencing system reagents; including sequencing pr...
Embodiment 2
[0050] Operation process of blood genomic DNA extraction kit (Tiangen Bio):
[0051] (1) Extract genomic DNA from blood
[0052] 1) Draw 300μl of blood and add 900μl of red blood cell lysate, mix by inversion, and leave it at room temperature for 5 minutes, during which time, mix by inversion several times. Centrifuge at 12,000 rpm for 1 min, aspirate the supernatant, leave the white blood cell pellet, add 200 μl of buffer GA, and shake until thoroughly mixed.
[0053] 2) Add 20μl proteinase K solution and mix well.
[0054] 3) Add 200μl of buffer GB, fully invert and mix well, place at 70°C for 10 minutes, the solution should be clear, and centrifuge briefly to remove the water droplets on the inner wall of the cap.
[0055] 4) Add 200μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove the water droplets on the inner wall of the cap.
[0056] 5) Add the solution and flocculent precipitate obtained in...
Embodiment 3
[0084] Take 15 clinical samples, extract the genome, prepare reagents and test according to the methods described in Examples 1 and 2. Add 1μl of the sample to the PCR reaction solution of the detection system. The results of electrophoresis are as figure 2 It is shown that the primers of the present invention can effectively amplify blood samples with a single band.
[0085] The test results of the sample are as image 3 Shown:
[0086] image 3 This is the sequencing screenshot of the 101175th base of intron 7 of the sample ATRX gene.
[0087] It can be seen from the detection result that the primer of the present invention has included the sequence of the mutation region and can expand the ATRX gene No. 7 intron, and the sequencing result is completely accurate. Among them, there is a mutation at base 101175 of intron No. 7, which is 101175C> T, the mutation site has not been reported in the known literature. The results of sequencing multiple samples show that this mutation ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com