Primers and method for detecting mutation of GNAS genetic locus
A technology of gene loci and sequencing primers, which is applied in the fields of life science and biology, can solve problems such as unclear functions, and achieve the effects of difficult detection, high cost, and reduced cost and difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The present invention will be further described below in conjunction with specific embodiments and accompanying drawings. It should be noted that the routine conditions and methods not described in the examples are generally used by experimenters in the field: for example, the fourth edition of the "Refined Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the procedures and conditions recommended by the manufacturer.
[0029] A primer for detecting mutations in GNAS gene sites. The primers are designed for mutation hotspots of exon 5 12384GCC>GCT and 12450ATC>ATT sites, including:
[0030] The primers for amplifying the hotspot region of GNAS gene mutation, its base sequence is:
[0031] GNAS-EXON-5-F: TGTAAAACGACGGCCAGTGCAGTGAGAAGGCAACCAA
[0032] GNAS-EXON-5-R: AACAGCTATGACCATGGGCTGTCACTCATGTTCCTAT
[0033] A test kit for detecting mutations in GNAS gene sites, comprising
[0034] (i) Blood DNA extraction reagents;
[0035] (ii) detecti...
Embodiment 2
[0042] The operation process of the blood genomic DNA extraction kit (Tiangen Biology):
[0043] (1) Genomic DNA extraction from blood
[0044] 1) Take 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed.
[0045] 2) Add 20 μl proteinase K solution and mix well.
[0046] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0047] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0048] 5) Add the solution and floccul...
Embodiment 3
[0076] Fifteen clinical samples were taken, and the genome was extracted, reagents were prepared and tested according to the methods described in Examples 1 and 2. Add 1 μl of the sample to the detection system PCR reaction solution. Electrophoresis results such as figure 2 As shown, it shows that the primers of the present invention can effectively amplify blood samples, and the band is single.
[0077] The test results of the samples were image 3 and Figure 4 shown. image 3 and Figure 4 Sequencing screenshots of the negative and positive samples at base 12384 of exon 5 of the GNAS gene. Figure 5 and Image 6 Sequencing screenshots of the negative and positive samples at base 12,450 of exon 5 of the GNAS gene.
[0078] It can be seen from the detection results that the primers of the present invention have included the sequence of the hotspot region, and can amplify exon 5 of the GNAS gene, and the sequencing results are completely accurate. Among them, there ar...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap