Primers, kit and method for detecting mutation of intron 4 in gene ABCG8
A technology of introns and sequencing primers, applied in the fields of life sciences and biology, can solve problems such as mutations that have not been reported, and achieve the effects of high cost, low cost and difficulty, and difficult detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Extraction of DNA in blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge a...
Embodiment 2
[0035] PCR amplification:
[0036] The PCR amplification system reagent preparation method is as follows:
[0037]
[0038] The reaction conditions are as follows:
[0039]
[0040] Among them, the primer sequence is:
[0041] ABCG8-intron4-F:TGTAAAACGACGGCCAGTCACCTCTCTAGGGGCTGGTC
[0042] ABCG8-intron4-R: AACAGCTATGACCATGCGGAAGGCAAGCTGAGTTGT.
Embodiment 3
[0044] Purification of PCR products: Enzyme purification was configured as follows according to the system: CIP (NEB Company) 0.1 μl, ExoI (NEB Company) 0.5 μl, deionized water 1.4 μl; finally add 9 μl of PCR product. The purification reaction procedure is as follows: 50 min at 37°C, 5 min at 95°C.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



