Primer for detecting congenital renal diabetes insipidus AVPR2 gene mutation, method thereof and kit

A technology of AVPR2-E2-F and AVPR2-E2-R, which is applied in the field of life science and biology, can solve the problem of reducing the coupling between AVP receptor and Gs protein, and achieve the effect of saving detection cost and simplifying operation steps

Pending Publication Date: 2019-12-13
济南艾迪康医学检验中心有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Certain mutations, although not affecting protein synthesis, significantly reduced the coupling of AVP receptors to Gs proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting congenital renal diabetes insipidus AVPR2 gene mutation, method thereof and kit
  • Primer for detecting congenital renal diabetes insipidus AVPR2 gene mutation, method thereof and kit
  • Primer for detecting congenital renal diabetes insipidus AVPR2 gene mutation, method thereof and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] The primers for detecting the AVPR2 gene locus of congenital nephrogenic diabetes insipidus include: 5 pairs of forward and reverse primers for amplifying and detecting the whole exon of the AVPR2 gene of congenital nephrogenic diabetes insipidus; the base sequence of the extended primers for:

[0062] TGGAGGCTATGGCAGTG AVPR2-E1-F GAGGGTGAAGGAGGTCTTTAG AVPR2-E1-R GGGTGTGTATCCCTCATAACA AVPR2-E2-F GCAATCCAGGTGACATAGG AVPR2-E2-R GCTCTTCATCTTCGCCC AVPR2-E2-F GCCCAGCACAGCACATA AVPR2-E2-R GCCAAGACTGTGAGGATGA AVPR2-E2-3-F ACACGCTGCTGCTGAAA AVPR2-E2-3-R ACCAGCCATCCTGAACC AVPR2-E3-F CTCCACACCCCACCGTTA AVPR2-E3-R

[0063] The primers also include sequencing primers, the base sequence of which is

[0064] M13-F: TGTAAAACGACGGCCAGT

[0065] M13-R: AACAGCTATGACCATG

[0066] In the detection, first use the above-mentioned forward and reverse primers to amplify the DNA fragment of the AVPR gene of congeni...

Embodiment 2

[0076] The operation process of the blood DNA extraction kit (Tiangen Biology):

[0077] (1) Genomic DNA extracted from blood:

[0078] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.

[0079] 2) Add 20 μl proteinase K solution and mix well.

[0080] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0081] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0082] 5) Put the solution and flocculent prec...

Embodiment 3

[0110] One whole blood sample was taken from the clinical proband, the proband's mother, the proband's father, and the proband's grandmother, and the AVPR2 gene mutation of these 4 samples was detected. The genome was extracted, reagents were prepared and tested according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. Detect with common PCR instrument, the time is 160 minutes.

[0111]It can be seen from the detection results that the primers of the present invention can detect the AVPR2 gene of congenital nephrogenic diabetes insipidus, and the sequencing results are completely accurate. The primers of the present invention can accurately amplify the congenital nephrogenic diabetes insipidus AVPR2 gene, no matter it is wild type or mutant type. The detection of positive samples shows that the primers, method and kit of the present invention can detec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting congenital renal diabetes insipidus AVPR2 gene mutation, a primer and a kit. The primer and the kit respectively comprise an amplification primer and a sequencing primer for congenital renal diabetes insipidus AVPR2 gene whole exons. Based on PCR amplification and Sanger sequencing, the congenital renal diabetes insipidus AVPR2 gene mutation conditioncan be rapidly detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer and a method for detecting the AVPR2 gene mutation of congenital nephrogenic diabetes insipidus. Background technique [0002] Congenital nephrogenic diabetes insipidus (CNDI) is a disease characterized by normal or elevated plasma arginine vasopressin (AVP) levels, but the kidneys cannot normally concentrate urine. CNDI usually develops in the first year of life, and its clinical features include polyuria, polydipsia, vomiting, loss of appetite, constipation, fever, and growth retardation. AVP is the main hormone that regulates the reabsorption function of the kidney. It is secreted by the posterior pituitary gland, increases in hypovolemia or hypernatremia, reaches the kidney through the blood circulation, and binds to the AVP receptor (V2R) located on the basolateral side of the collecting duct cells. Activated V2R increases intracellular cAM...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2531/113C12Q2525/191C12Q2535/101C12Q2545/113
Inventor周桂兰
Owner济南艾迪康医学检验中心有限公司