Primer and method for detecting gene mutation of mitochondria related drug-induced deafness
A drug-induced deafness and mitochondrial technology, which is applied in the fields of medicine and biology, can solve the problems of expensive equipment, high requirements for technicians, and high cost of reagents
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A primer for detecting polymorphic mutation sites of mitochondrial mtDNA 12S rRNA. The primer design is an amplification primer designed for mitochondrial mtDNA 12S rRNA, including:
[0044] The primers used to amplify the mitochondrial mtDNA 12S rRNA gene have the base sequence:
[0045] XLT–F: GGTGCTTTGTGTTAAGCTAC
[0046] XLT–R: ATGAAACTTAAGGGTCGAAG
[0047] A kit for detecting mitochondrial mtDNA 12S rRNA polymorphic mutation sites, including
[0048] (i) Blood DNA extraction reagent;
[0049] (ii) PCR reaction solution of detection system;
[0050] (iii) Sequencing system reagents;
[0051] Among them, tissue DNA extraction reagents can be purchased from commercial reagents such as Tiangen DNA Extraction Kit.
[0052] The PCR amplification reaction solution of the detection system includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); mitochondrial mtDNA 12S rRNA gene sequence upstream and downstream primers XLT-F / R primer concentration is 10μM.
[0053] Sequencing sys...
Embodiment 2
[0055] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Bio):
[0056] (1) Extract tissue DNA from blood: 1) Draw 300 μl of blood and add 900 μl of red blood cell lysate, mix upside down, place it at room temperature for 5 minutes, and mix upside down several times during the process. Centrifuge at 12000 rpm for 1 min, aspirate the supernatant, leave the white blood cell pellet, add 200 μl of buffer GA, and shake until thoroughly mixed. 2) Add 20μl proteinase K solution and mix well. 3) Add 200μl of buffer GB, fully invert and mix well, place at 70°C for 10 minutes, the solution should be clear, and centrifuge briefly to remove the water droplets on the inner wall of the cap. 4) Add 200μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove water droplets on the inner wall of the cap. 5) Add the solution and flocculent precipitate obtained in the previous step to an adso...
Embodiment 3
[0084] Take 16 clinical samples (sample numbers 1-16) according to the reagents and methods of Examples 1 and 2 to extract genome, prepare reagents, amplify and sequence. Add 1μl of each sample to the PCR reaction solution of the detection system. The results of electrophoresis are as figure 2 It shows that the primer XLT-F / R of the present invention can effectively amplify blood samples and has a single band.
[0085] The partial sequencing test results of sample 1 are as follows image 3 , 4 Shown. image 3 Shown is the wild-type sequencing screenshot of the mitochondrial mtDNA 12SrRNA gene A1555G site of sample 1. Figure 4 Shown is the wild-type sequencing screenshot of the mitochondrial mtDNA 12S rRNA gene C1494T site of sample 1.
[0086] It can be seen from the detection result that the primer of the present invention has included A1555G and C1494T, and can expand the DNA fragments where the mitochondrial mtDNA 12S rRNA genes A1555G and C1494T are located, and the sequenci...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com