Primer and method for detecting gene mutation of mitochondria related drug-induced deafness

A drug-induced deafness and mitochondrial technology, which is applied in the fields of medicine and biology, can solve the problems of expensive equipment, high requirements for technicians, and high cost of reagents

Inactive Publication Date: 2018-04-06
WUHAN ADICON CLINICAL LAB
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Fluorescent quantitative PCR method needs to design multiple probes for different mutation types, which is costly and difficult to detect
Restriction fragment length polymorphism technology can only detect a single mutation site, if multiple sites need to be detected, multiple PCRs are required, the operation is complicated and the workload is heavy
Denaturing high performance liquid chromatography can accurately quantify mtDNA 1555A>G mutation load, but this method is highly automated, expensive equipment, and requires high technical personnel, which limits its clinical application, so it is mostly used in scientific research
Gene chips are also not applicable and widely used in clinical practice due to the high cost of reagents and expensive equipment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting gene mutation of mitochondria related drug-induced deafness
  • Primer and method for detecting gene mutation of mitochondria related drug-induced deafness
  • Primer and method for detecting gene mutation of mitochondria related drug-induced deafness

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] A primer for detecting polymorphic mutation sites of mitochondrial mtDNA 12S rRNA. The primer design is an amplification primer designed for mitochondrial mtDNA 12S rRNA, including:

[0044] The primers used to amplify the mitochondrial mtDNA 12S rRNA gene have the base sequence:

[0045] XLT–F: GGTGCTTTGTGTTAAGCTAC

[0046] XLT–R: ATGAAACTTAAGGGTCGAAG

[0047] A kit for detecting mitochondrial mtDNA 12S rRNA polymorphic mutation sites, including

[0048] (i) Blood DNA extraction reagent;

[0049] (ii) PCR reaction solution of detection system;

[0050] (iii) Sequencing system reagents;

[0051] Among them, tissue DNA extraction reagents can be purchased from commercial reagents such as Tiangen DNA Extraction Kit.

[0052] The PCR amplification reaction solution of the detection system includes: 2×PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U / μl); mitochondrial mtDNA 12S rRNA gene sequence upstream and downstream primers XLT-F / R primer concentration is 10μM.

[0053] Sequencing sys...

Embodiment 2

[0055] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Bio):

[0056] (1) Extract tissue DNA from blood: 1) Draw 300 μl of blood and add 900 μl of red blood cell lysate, mix upside down, place it at room temperature for 5 minutes, and mix upside down several times during the process. Centrifuge at 12000 rpm for 1 min, aspirate the supernatant, leave the white blood cell pellet, add 200 μl of buffer GA, and shake until thoroughly mixed. 2) Add 20μl proteinase K solution and mix well. 3) Add 200μl of buffer GB, fully invert and mix well, place at 70°C for 10 minutes, the solution should be clear, and centrifuge briefly to remove the water droplets on the inner wall of the cap. 4) Add 200μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent precipitation may appear. Centrifuge briefly to remove water droplets on the inner wall of the cap. 5) Add the solution and flocculent precipitate obtained in the previous step to an adso...

Embodiment 3

[0084] Take 16 clinical samples (sample numbers 1-16) according to the reagents and methods of Examples 1 and 2 to extract genome, prepare reagents, amplify and sequence. Add 1μl of each sample to the PCR reaction solution of the detection system. The results of electrophoresis are as figure 2 It shows that the primer XLT-F / R of the present invention can effectively amplify blood samples and has a single band.

[0085] The partial sequencing test results of sample 1 are as follows image 3 , 4 Shown. image 3 Shown is the wild-type sequencing screenshot of the mitochondrial mtDNA 12SrRNA gene A1555G site of sample 1. Figure 4 Shown is the wild-type sequencing screenshot of the mitochondrial mtDNA 12S rRNA gene C1494T site of sample 1.

[0086] It can be seen from the detection result that the primer of the present invention has included A1555G and C1494T, and can expand the DNA fragments where the mitochondrial mtDNA 12S rRNA genes A1555G and C1494T are located, and the sequenci...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer and a method for detecting gene mutation of mitochondria related drug-induced deafness. The primer comprises primers which amplify a mitochondria mtDNA12SrRNA gene sequence, wherein a Sanger sequencing technology and sequencing primers are adopted. According to the method, A1555G and C1494T mutation in a patient can be detected quickly. The detection result is accurate and the method can be used as an effective method of diagnosing hereditary hearing loss of a new born in an auxiliary agent. The primer and method have important reference meaning in early detection and treatment of the disease, rational drug use in infant period and individual treatment, and avoid the tragedy of deafness induced by one needle.

Description

Technical field [0001] The invention belongs to the field of medicine and biotechnology, and specifically relates to primers and methods for detecting mutations of mitochondrial mtDNA 12S rRNA genes, which are mitochondrial-related drug-induced deafness genes. Background technique [0002] Deafness is the most common disease that causes speech communication disorders. In China, there are more than 20 million hearing-impaired people, about 800,000 children, and 80,000 new deaf children every year. Most of these patients suffer from sensorineural deafness that severely affects communication and is difficult to treat. Deafness caused by genetic factors accounts for more than 50%. Deafness caused by genetic factors includes syndrome deafness (30%) and non-syndromic deafness (70%). The mutations mainly include GJB2, GJB3, SLC26A4 and mitochondrial 12SrRNA. The survey showed that 3.4% of deaf patients were caused by the sensitive individuals who used ototoxic drugs. Drug-induced deaf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6883C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6883C12Q2600/156
Inventor 刘赵玲吴鹏飞王淑一
Owner WUHAN ADICON CLINICAL LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap