Primers and method for detecting c.55C>G and c.238C>T site mutation of ATP8B1 gene
A technology of c.55c and ATP8B1-EXON1-R, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problem of limited number of patients and achieve cost reduction, difficulty and cost High and difficult to detect effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The present invention will be further described below in conjunction with specific embodiments and accompanying drawings. It should be noted that the conventional conditions and methods not described in the examples are generally used by experimenters in the field: for example, the fourth edition of the "Refined Molecular Biology Experiment Guide" edited by Osper and Kingston, Or follow the procedures and conditions recommended by the manufacturer.
[0039] A primer for detecting the c.55C>G, c.238C>T site mutation of the ATP8B1 gene, the primer is a specific amplification product designed for the c.55C>G, c.238C>T site mutation Primers, including:
[0040] Primers for amplifying bases c.55C and c.238 of the ATP8B1 gene, the base sequence of which is:
[0041] ATP8B1-EXON1-F:TGTAAAACGACGGCCAGTTAGGGAGGGAAAAAGGGAG
[0042] ATP8B1-EXON1-R:AACAGCTATGACCATGATCCCGGATCTCCAAAGT
[0043] A kit for detecting the c.55C>G, c.238C>T site mutations of the ATP8B1 gene, comprising ...
Embodiment 2
[0052] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0053] (1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step ...
Embodiment 3
[0079] Take 10 cases of clinical peripheral blood samples, extract the genome, prepare reagents and detect according to the method described in Example 2. Add 2 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. After sequencing, it was found that the gene mutation of ATP8B1 c.55 site had mutations in samples 2, 4, and 10, and all other samples had no mutations; ATP8B1c.238 site samples 2 and 10 had mutations, and all other samples had no mutations. The mutation status of samples 1-10 is shown in the table below, and the results of agarose gel electrophoresis are as follows figure 1 As shown, the positive sequencing graph is shown in Figure 2-3 shown.
[0080] c.55C>G c.238C>T 1 - - 2 + + 3 - - 4 + - 5 - - 6 - - 7 - - 8 - - 9 - - 10 + + The detection mutation rate 30% 20% reported mutation rate No report No r...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com