Accurate and efficient editing method of upland cotton genome

A genome and upland cotton technology, applied in the field of genetic engineering, can solve the problems of complex and huge genome, and no reports of allotetraploid cotton, and achieve highly specific effects

Active Publication Date: 2019-09-27
HUAZHONG AGRI UNIV
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Currently, the Cpf1 nuclease editing system has been reported in many species, but not in allotetraploid cotton
Upland cotton is a widely planted allotetraploid (AtDt). Many genes in its genome are highly homologous, and the genome is relatively complex and large. The traditional CRISPR-Cas9 system needs to carry out some specific genes Powerless when editing and function analysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Accurate and efficient editing method of upland cotton genome
  • Accurate and efficient editing method of upland cotton genome
  • Accurate and efficient editing method of upland cotton genome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Amplification of LbCpf1-NLS-3xHA target sequence

[0037] Using pHUN611 vector (sequence list as SEQ ID NO: 2) as a template for PCR amplification, the target sequence LbCpf1-NLS-3xHA (sequence list as SEQ ID NO: 4) was obtained. The primers for amplification are:

[0038] LbCpf / F:AAAAAGCAGGCTTCGAAATGTCCAAGCTGGAGAAGTTTACA,

[0039] And LbCpf / R: GAAAGCTGGGTCTAGATTAGGCATAGTCGGGGACATC;

[0040] The PCR reaction system is shown in Table 1.

[0041] Table 1 PCR reaction system of LbCpf1-NLS-3xHA sequence

[0042]

Embodiment 2

[0043] Example 2: Construction of transformation vector GhRBE3

[0044] Double-enzyme digestion of pRGEB32-GhU6.7-NPTⅡ (see SEQ ID NO: 1 for the sequence list). The digestion system is shown in Table 2. The digestion product is digested at 37°C for 5 hours, and the digested product is observed by gel electrophoresis. Add 4 μL of BstbI, digest the enzyme at 65°C for 20 minutes, observe whether the digested band is correct by gel electrophoresis, and then use a gel recovery kit (purchased from OMEGA, catalog number D2500-02) to purify the digested product. The enzyme digestion system is shown in Table 2.

[0045] Table 2 Restriction digestion system of pRGEB32-GhU6.7-NPTⅡ

[0046]

[0047] Connect the digested pRGEB32-GhU6.7-NPTⅡ vector and the LbCpf1-NLS-3xHA fusion protein fragment through the ClonExpress II One Step Cloning Kit (Vazyme C112-02), transform it into E. coli competent, and pick the positive clones. After sequencing, the plasmid with the correct sequence was named GhRB...

Embodiment 3

[0051] Example 3: Construction of GhRBE3-crRNA vector

[0052] 1. The crRNA design of GhCLA gene

[0053] The Gh_A10G2292 gene of upland cotton 1-deoxyxylulose-5-phosphate synthase (Cloroplasto alterados, CLA) was selected as the verification gene. The bioinformatics software sgRNAcas9_3.0.5 (Xie et al 2014) was used to design a crRNA target sequence with the PAM sequence "-TTTV" in the gene exon region, and one crRNA was selected to construct a plant expression vector for the gene editing system. The sequence of the crRNA is shown in Table 4.

[0054] Table 4 Sequence of crRNA

[0055]

[0056] 2. Connection of crRNA and GhRBE3 vector

[0057] The target inserted into the GhRBE3 vector sequence is a repetitive sequence of tRNA-crRNA-gRNA. The target sequence is obtained by gene synthesis, and then amplified by PCR and connected to the GhRBE3 vector. Now take crRNA as an example. The PCR primers are as follows: pRGEB32-7 / S:aagcatcagatgggcaAACAAAGCACCAGTGGTC, CLA1 / AS:TCTAGCTCTAAAACTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant gene engineering and particularly relates to an accurate and efficient editing method of an upland cotton genome. A pRGEB32-GhU6.7-NPT II vector containing a cotton endogenous promoter pGhU6-7 is modified, original Cas9 protein is replaced with LbCpf1 protein, and a vector GhRBE3 with editing capacity in cotton is constructed. GhCLA is selected as a target gene to verify application of GhRBE3 in cotton. One target is designed, a Cpf1 gene editing system is imported into the cotton genome by agrobacterium tumefaciens mediated genetic transformation, Sanger sequencing and high-throughput sequencing are performed on transgenic plants to detect the editing efficiency and the off-target effect of the method in the allotetraploid cotton genome. The method has good editing efficiency and specificity.

Description

Technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an accurate and efficient editing method of upland cotton genome. The invention includes the construction of an efficient transformation vector for upland cotton, and the constructed vector is used for precise editing in the upland cotton functional genome. Background technique [0002] The CRISPR / Cas system (Clustered regularly interspaced short palindromic repeats / CRISPR-associated protein) is an acquired immune defense mechanism that bacteria and archaea continue to evolve from the invasion of foreign viruses and phages. The CRISPR / Cas9 system is currently the most widely used gene editing system, which can efficiently, specifically and flexibly identify specific sites in target genes. However, with the continuous deepening of research, CRISPR / Cas9 has also exposed more serious off-target effects (Hsu et al 2014), the limitation of PAM sequence results in fe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66
CPCC12N15/66C12N15/8213C12N2810/10
Inventor金双侠李波芮杭萍李亚军王琼琼张献龙
OwnerHUAZHONG AGRI UNIV