Genetic marker related to growth trait of goat and application thereof
A technology of genetic markers and growth traits, applied in the field of genetic markers and applications, can solve the problem of unreported gene polymorphism information
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] (1). Cloning of partial genome sequence of SKIP gene and establishment of polymorphism detection method
[0024] (1) Primer design:
[0025] Using sheep SKIP genomic DNA (GenBank accession number: NC_019468.1) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank goat Genomes database, and obtain a homologous sequence located on goat chromosome 19 with a similarity of 97%. Homologous SKIP genome sequence. Amplification primers were designed according to the goat SKIP genome sequence (forward primer 5'GGCTTCCCTTCTCCAGCATA3'; reverse primer 5'AACTGGGGTTTGGGTCTTT3'). Taking Macheng black goat and Boer goat as the experimental population, the blood genome DNA of the goat was extracted, and the DNA of the two goat breeds was mixed to construct a DNA pool as a template to amplify part of the goat SKIP gene fragment.
[0026] After PCR product purification and sequencing, and obtain the nucleotide sequence as shown in sequence ta...
Embodiment 2
[0037] The experimental materials used for correlation analysis were 318 Boer goats and Macheng black goats from the breeding farm of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. The traits analyzed were mainly growth traits. Growth traits include body weight, body height, body oblique length, chest girth, tube girth, etc. of goats measured at 3, 6, 12, 18, and 24 months of age. First adopt the PCR-Bg1I-RFLP method established in embodiment 1 to carry out individual genotyping, adopt SAS8.0 statistical software (SAS Institute Inc, Version8Edition) to analyze data, GLM program carries out the association analysis between marker and character, The REG program calculates the additive effect and dominant effect of the gene, and performs a significance test to analyze the correlation between the different genotypes of the goat SKIP gene Bg1I-RFLP and the growth traits of goats. Statistical models were established. Except for ra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 