Check patentability & draft patents in minutes with Patsnap Eureka AI!

Genetic marker related to growth trait of goat and application thereof

A technology of genetic markers and growth traits, applied in the field of genetic markers and applications, can solve the problem of unreported gene polymorphism information

Inactive Publication Date: 2014-09-03
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the study of SKIP gene in goats is still blank, and the polymorphism information of the gene has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker related to growth trait of goat and application thereof
  • Genetic marker related to growth trait of goat and application thereof
  • Genetic marker related to growth trait of goat and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] (1). Cloning of partial genome sequence of SKIP gene and establishment of polymorphism detection method

[0024] (1) Primer design:

[0025] Using sheep SKIP genomic DNA (GenBank accession number: NC_019468.1) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank goat Genomes database, and obtain a homologous sequence located on goat chromosome 19 with a similarity of 97%. Homologous SKIP genome sequence. Amplification primers were designed according to the goat SKIP genome sequence (forward primer 5'GGCTTCCCTTCTCCAGCATA3'; reverse primer 5'AACTGGGGTTTGGGTCTTT3'). Taking Macheng black goat and Boer goat as the experimental population, the blood genome DNA of the goat was extracted, and the DNA of the two goat breeds was mixed to construct a DNA pool as a template to amplify part of the goat SKIP gene fragment.

[0026] After PCR product purification and sequencing, and obtain the nucleotide sequence as shown in sequence ta...

Embodiment 2

[0037] The experimental materials used for correlation analysis were 318 Boer goats and Macheng black goats from the breeding farm of the Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences. The traits analyzed were mainly growth traits. Growth traits include body weight, body height, body oblique length, chest girth, tube girth, etc. of goats measured at 3, 6, 12, 18, and 24 months of age. First adopt the PCR-Bg1I-RFLP method established in embodiment 1 to carry out individual genotyping, adopt SAS8.0 statistical software (SAS Institute Inc, Version8Edition) to analyze data, GLM program carries out the association analysis between marker and character, The REG program calculates the additive effect and dominant effect of the gene, and performs a significance test to analyze the correlation between the different genotypes of the goat SKIP gene Bg1I-RFLP and the growth traits of goats. Statistical models were established. Except for ra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of preparation of molecular markers and particularly relates to a genetic marker related to growth trait of a goat and application thereof. The genetic marker is a gene fragment which is cloned from an SKIP gene of the goat, shown in a sequence table SEQID NO:1 and related to the growth trait of the goat, wherein the sequence length is 680bp. An allele mutant (base substitution) is arranged at 413bp of the sequence as shown in the sequence table SEQID NO:1, and the mutant leads to Bg1I-RFLP polymorphism. The invention further discloses a preparation method of the genetic marker and application of the genetic marker in detecting polymorphism of the growth trait of the goat. The genetic marker provided by the invention can be applied to marker assisted selection of the goat.

Description

technical field [0001] The invention belongs to the technical field of animal molecular markers, in particular to a genetic marker related to goat growth traits and its application. The genetic marker is cloned from a SKIP gene fragment. Background technique [0002] With the development of my country's economy and the improvement of people's living standards, the demand for mutton is increasing year by year. Compared with commercial pig production, local goats generally have disadvantages such as small size, slow growth rate, and low slaughter rate. It has become a new trend in the mutton sheep industry to research and breed new varieties of green goats with fast growth and local flavors that meet the needs of the modern market, and to establish an efficient breeding technology system. With the development of molecular biology technology, the combination of molecular marker-assisted selection and traditional breeding methods has become one of the main methods adopted in l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/11C12N15/10C12Q1/68
Inventor 熊琪陈明新张年李晓锋索效军杨前平刘洋田宏张鹤山熊军波
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More