Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

86 results about "Genetypes" patented technology

Genetypes is a taxonomic concept proposed in 2010 to describe any genetic sequences from type specimens. This nomenclature integrates molecular systematics and terms used in biological taxonomy. This nomenclature is designed to label, or flag, genetic sequences that were sampled from type specimens. The nomenclature of genetypes proposes that genetic sequences from a holotype should be referred to as a “hologenetype” (from: holotype and genetype), sequences from a topotype will be a “topogenetype,” and so forth. In addition, the genetic marker(s) used should also be incorporated into the nomenclature (e.g., paragenetype ND2).

Primer system for detecting gene SNP (single nucleotide polymorphism) related to warfarin dosage and application of primer system

The invention discloses a primer system for detecting 7 gene polymorphic sites related to warfarin dosage. A product prepared based on the primer system can be used for realizing the detection of 7 gene polymorphic sites related to warfarin dosage. The product is used so as to detect the genetypes of a warfarin user at the 7 gene polymorphic sites; and the detection result is combined with other clinical indexes so that a reference can be provided for a clinical doctor to reasonably define the warfarin dosage, and the side effect of a medicament is avoided. According to the invention, the primer system can be used for simultaneously detecting the 7 gene polymorphic sites on different genes in one reaction system; and compared with technologies such as sequence measurement and real-time fluorescencent quantitative PCR (polymerase chain reaction), the primer system disclosed by the invention has the advantages of lower cost, simplicity and convenience in operation and improved accuracy and sensitivity.
Owner:毅新兴业(北京)科技有限公司

Method and system for implementing typing based on polymerase chain reaction sequencing

The invention discloses a method and system for polymerase chain reaction sequencing-based typing (PCR-SBT). The method comprises the following steps: a heterozygote site and a base sequence to be typed are interpreted through a computer program according to a sequencing result; the base sequence to be typed is compared to a typing database of a corresponding site, an alignment position relation between the base sequence to be typed and reference sequences in the typing database is recognized; an allelic genetype in the typing database is searched, a penalty score of the allelic genetype in the typing database is obtained according to a sequencing strategy; and a candidate type group set is obtained according to the penalty score of the allelic gene type in the typing database. In the SBT method and system provided by the invention, automatic recognition of candidate genetypes can be achieved through a computer and other devices, thereby improving typing efficiency; and the convenience is provided for confirmation and modification of typing of typing personnel through imaging interface display and other technical means, thus typing accuracy and typing efficiency are provided.
Owner:BGI SHENZHEN CO LTD

Primers for detecting ApoE gene polymorphism, kit and PCR (polymerase chain reaction) method for primers or kit

The invention discloses primers for detecting ApoE gene polymorphism, a kit and a PCR (polymerase chain reaction) method for the primers or the kit. The primers include two sets of primers for detecting an rs429358 site and an rs7412 site respectively; the first set of primers include a mutant-type specific upstream primer of the rs429358 site, a wild-type specific upstream primer of the rs429358 site and a first downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs429358 site; the second set of primers include a mutant-type specific upstream primer of the rs7412 site, a wild-type specific upstream primer of the rs7412 site and a second downstream primer shared by the mutant-type specific upstream primer and the wild-type specific upstream primer of the rs7412 site. The kit has the advantages of simplicity, quickness, accuracy and low price for detection and the like, and provides a powerful tool for scientific research and clinical analysis of ApoE gene typing and gene mutation.
Owner:沈阳优吉诺生物科技有限公司

Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof

The invention provides a molecular marker of major gene Bph6 resistant to brown planthopper and an application thereof. The invention can obtain a pest-resistant cultivar Swarnalata resistance gene Bph6 and position the resistance gene between molecular marker Y1 and molecular marker Y9 by hybridizing a rice pest-resistant cultivar Swarnalata with 9311 (female) to obtain the genetype of each F2 plant and performing genetic linkage analysis by combining resistance levels resistant to brown planthopper of each family of F2:3. The molecular marker linked with the resistance gene is one of RM16994, Y19, Y9, RM119, RM5757, RM16999, RM17004 and RM17008. The molecular marker in the invention can effectively detect whether the major gene locus exists in the pest-resistant cultivar Swarnalata and derived varieties (strains) thereof, thus greatly improving the selection efficiency of rice resistant to brown planthopper and obtaining brown planthopper resistant rice varieties containing Bph6 gene.
Owner:WUHAN UNIV

Detection method and kit of single nucleotide polymorphism locus rs7550536 of susceptibility gene of hypertension

The invention belongs to the molecular biology and medicine field and relates to a method for detecting a susceptibility gene of hypertension and a detection kit thereof. The invention provides a method for detecting a susceptibility gene of essential hypertension, comprising the step of detecting the genetype of a mitochondrion fusion gene 2(Mfn2) / hyperplasia suppressor gene (HSG) locus rs7550536. The individual, rs7550536 of which carries the T genetype has obviously higher susceptibility of hypertension than the common people. The invention also discloses the corresponding detection kit which contains a primer amplifying the locus rs7550536 and a primer amplifying the region of the locus rs7550536 contained in the No.14 intron of the Mfn2 gene. Being used for detecting the genetype of the locus rs7550536, the method is simple and practicable, fast and efficient and low in cost and provides a simple and direct new way for hypertension diagnosis and treatment.
Owner:BEIJING ANZHEN HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV +1

Thalassemia gene detection method based on high-throughput sequencing technology

The invention discloses a thalassemia gene detection method based on a high-throughput sequencing technology. The thalassemia gene detection method mainly comprises the following steps that alpha & beta-thalassemia related gene fragments are specifically amplified based on PCR amplification primers of a span breakpoint and a mutation site designed by adopting a Gap-PCR method, library establishment is conducted on PCR products, library products are subjected to high-throughput sequencing, sequencing data uses a human genome hg19 as a reference sequence, sequencing depth values of gene loci in a target area chr16: 215000-236000 are analyzed according to a sequence alignment score Q10, and alpha-thalassemia deletion types are determined according to the distribution of the sequencing depth values of different loci; meanwhile sequence alignment is performed through the target area chr16: 215000-236000 and a target area chr16: 5246400-5248600, and alpha & beta-thalassemia mutation types are determined according to the basic types of specific sites. By the adoption of the thalassemia gene detection method, simultaneous detection of 6 mutation genetypes of alpha-thalassemia and 26 mutation genetypes of beta-thalassemia can be achieved.
Owner:GUANGZHOU DARUI BIOTECH

Primer pair, fluorescence probe and kit for detecting polymorphism of MTHFR gene

The invention provides a primer pair, specific oligonucleotide fluorescence probe and kit for detecting the nucleotide polymorphism of a C677T locus of an MTHFR gene. The new specific primer pair and the corresponding fluorescence probe are designed, PCR amplification is performed by adopting an asymmetric PCR technology, melting curve analysis is performed after PCR amplification is finished, and a genetype is judged through the melting peak at specific temperature. According to the kit, the MTHFR gene can be amplified in a highly specific mode, detection of three kinds of genetypes of the C677T locus in a single-pipe PCR system can be completed, the detection specificity is high, the result is easy to judge and read, the operating steps are simple, the detection cost is low, the cycle is short, and the efficiency is high.
Owner:智海生物工程(北京)股份有限公司

Molecular marker tightly linked to fiber fineness of ramie, obtaining method and application thereof

The invention discloses a molecular marker tightly linked to fiber fineness of ramie and also discloses a method for obtaining the molecular marker tightly linked to fiber fineness of ramie. The method comprises the following steps: 1, a ramie germplasm SSR marker genetype is obtained; 2, the SSR marker genetype is analyzed and a K matrix graph is calculated; 3, a Q-value matrix is generated by the utilization of the SSR marker genetype; 4, by using the K matrix graph and the Q-value matrix as covariance, molecular marker data and fiber fineness quantitative character data are tested, and P and R2 (phenotypic variation interpretation ratio) data are output; 5, by using a PCA matrix and the K matrix graph as covariance, the molecular marker data and fiber fineness quantitative character data are tested, and P and R2 data are output; and 6, a SSR locus with P being less than 0.05 and R2 being less than 0.82 and greater than 0.45 is selected so as to obtain the molecular marker which controls fiber fineness of ramie and is tightly linked to fiber fineness of ramie. The invention also discloses an application of the molecular marker in ramie variety breeding and fiber fineness enhancement.
Owner:INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI

Creation method of sweet pepper SSR finger-print and application thereof

The invention discloses a creation method of sweet pepper SSR finger-print and an application thereof. The method is as follows: screening SSR primer for different sweet pepper varieties and inbred line total DNA to obtain 12 pairs of SSR polymorphism molecular markers, and performing electrophoretic separation to obtain corresponding SSR molecular marker polymorphism gram through the 12 pairs of SSR polymorphism molecular markers. The technology can make definite conclusion on the sweet pepper genetype, performs genetic classification to sweet pepper breeding material which is not recorded on an exact pedigree, makes up the deficiency of the pedigree record, also can be used for identifing the hereditary feature of the inbred line of sweet pepper, and protects the variety of the inbred line against invasion.
Owner:SHANGHAI ACAD OF AGRI SCI

Method for improving paddy rice grain type and weight

The invention belongs to the technical field of paddy rice molecule auxiliary breeding, and particularly relates to a method for obtaining materials of different grain sizes and different weights by utilizing polymerization grain type QTL. The method adopts a breeding process of once crossbreeding, three times of backcross and once selfing, so as to lead the target grain type QTL into a paddy rice variety to-be-improved, and built a plurality of near-isogenic lines under the background of improved variety heredity; then every two seeds are crossbred with each other according to the near-isogenic lines, so as to polymerize the target grain type QTL into a material to-be-improved, and obtain a genome of an improved variety and a singleplant same as the original variety except the target gene segment by screening the heredity background; meanwhile, the genetype of the target grain type QTL is judged according to a molecular marker tightly linked with the target grain type QTL with the assistant of molecular marker auxiliary selection. According to the scheme, paddy rice varieties of different grain sizes and different weights can be obtained.
Owner:HUAZHONG AGRI UNIV

Reagent for detecting antiepileptic drug allergic reaction associated antigen genetype and clinical application method

The invention relates to a reagent used for detecting antigen genotypes relevant to the anaphylactic reaction of antiepileptic drugs, and a clinical application method thereof. The reagent is characterized in that: 1) the reagent comprises Taq enzyme, a chain of seven tubes and a PCR primer; 2) the PCR primer is shown in the sequence list SEQ ID No.1. The clinical application method is characterized in that: 1) four pairs of the sequence specific primers and two pairs of internal reference primers are designed by utilizing a sequence specific primer PCR-SSP according to an HLA-B sequence, and PCR amplification is carried out by taking gDNA extracted from human peripheral blood or other issues as a template; 2) gel electrophoresis is adopted for the detection so as to confirm that the genotype of the sample is HLA-B multiplied by 1502. The reagent and the method of the invention have the advantages of simple operation, high accuracy and low cost, and are especially suitable for determining that whether the antiepileptic drugs such as carbamazepine, etc. can be taken by the HLA-B multiplied by 1502 genotype detection before patients in China or Asia take antiepileptic drugs such as the carbamazepine, etc.
Owner:THE SECOND AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIV

Scheme and application for increasing amylose content of corn seeds through overexpression of Sh2 and Bt2 genes and RNAi suppression expression of SBEIIa and SBEIIb genes

The invention relates to a scheme and application for increasing the amylose content of corn seeds through the overexpression of Sh2 and Bt2 genes and the RNAi suppression expression of SBEIIa and SBEIIb genes. A method comprises the following steps of: respectively fusing the Sh2 and Bt2 genes cloned from corns in righteous forms with specific promoters of endosperms; then recombining to a plant expression vector, and guiding to corn cells by adopting a transgenic technology to obtain transgenic plants with enlarged seeds and high starch content; altering the SBEIIa and SBEIIb genes to the corns with a same genetype by RNAi structures promoted by the specific promoters of the endosperms, screening plants with high amylose, and creating new corn germplasm and species with high amylose and seed yield through the hybridization of the transgenic plants, or recombining the RNAi structures of the Sh2 and Bt2 genes and the SBEIIa and SBEIIb genes to the same plant expression vector to obtain the transgenic plants with high seed yield and amylase and descendants thereof through the transgenic technology.
Owner:SHANDONG UNIV

Method for detecting sheep FecB gene polymorphism by use of SNaPshot technology

The invention provides a method for detecting sheep FecB gene polymorphism by use of the SNaPshot technology. The method is to conduct single nucleotide polymorphism detection on the 29382188bp site (NC_019463.1 on the sixth chromosome of sheep, based on sheep genomic sequence information version number Oar_v3.1, Dec, 2012) and judging whether the sheep FecB gene is homozygous or heterozygous according to the detection result. Compared with the traditional PCR-RFLP FecB gene detection method and other methods, the method provided by the invention is high in technical accuracy, quick in detection, low in cost, and easier in result identification, and can be used for automatically detecting the SNP site of the FecB gene. Through selection of the sheep FecB genetypes, GG homozygote individuals with high litter size character can be reserved to improve the sheep reproductive capacity, and the method has a potential application value in large-scale sheep breeding.
Owner:内蒙古河套农牧业技术研究院

Parkin gene mutation relating to Parkinson's disease and its detection method

The invention relates to the gene mutation relevant to the paralysis agitans and the detecting method, comprising: extracting DNA sample; designing primer; expanding with PCR; analyzing nucleic acid by means of dHPLC technology; testing the gene order of the sample which is dHPLC positive reaction to definite the genetype; carrying out beta-actin comparison for the sample of repeated extanding negative reaction to eliminate extron deletion mutation. The parkin gene mutation is in the codon promoter of the parkin gene, the second basic group in the exon1, ATG mutated to ACG; on the intersection point of thefifth introne and sixth extron in the exon6, AG mutated to AC; in the sixth extron, the 727th basic group, G mutated to A; in the exon9, the 1016th basic group, C mutated to T; in the position of ring finger intermediate region, in the Znf C6HC zinc region, GCG mutated to CGTC. By applying the gene mutation and the detection method, the detection for the mutation site of the parkin fene is high-effective and low-cost, and the diagnose to the potential PD patient can be made in an early stage.
Owner:XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI

SNP molecular marker related to breast muscle weight and breast muscle percentage of chicken and application of SNP molecular marker

The invention provides an SNP molecular marker related to the breast muscle weight and the breast muscle percentage of a chicken and application of the SNP molecular marker. The invention finds that the SNP molecular marker remarkably related to the breast muscle weight and the breast muscle percentage exists in a GJA1 gene on the basis of GWAS (Genome Wide Association Study). The invention provides a kit for detecting the SNP molecular marker; and the kit contains a pair of primers of which the nucleotide sequences are shown in SEQ ID NO. 1-2. The invention further provides a method for selecting a high-quality chicken pure line with high breast muscle weight and breast muscle percentage by utilizing the SNP site of the GJAI gene. The method comprises the following steps: obtaining a chicken genome DNA; detecting the genetype of the SNP T1289c site of the GJAI gene by virtue of the pair of primers of which the nucleotide sequences are shown in SEQ ID NO. 1-2; and selecting chicken individuals with superior genetype CC. The kit provided by the invention is simple to operate, high in flexibility, high in accuracy and low in detection cost and has an important application value.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Gene for controlling cucumber non-tendril character and cucumber tendril character-related SNP marker

The invention relates to a gene Csa5G644520 for controlling cucumber non-tendril character, and a cucumber tendril character-related SNP marker and an application of the gene. The SNP marker is located at the loci 1012bp of a cucumber gene Csa5G644520 shown in Seq ID No.2; the cucumber of which the basic group at the loci 1012bp is T has no tendril character; and the cucumber of which the basic group at the loci 1012bp is A has tendril character. The gene Csa5G644520 for controlling cucumber non-tendril character and the cucumber tendril character-related SNP marker are found out by a rare SNP method, a map-based cloning method and the like. The genetype of a to-be-detected cucumber is detected through a method of a derived cleaved amplified polymorphic sequence (dCAPS); and whether the cucumber plant has tendril or not can be judged according to the genetype, so as to accelerate the breeding process of the non-tendril cucumber.
Owner:INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI

Method and kit for quantitative detection of BCR-ABL fusion genes

The invention provides a method and kit for quantitative detection of BCR-ABL fusion genes. The specific technical scheme comprises that two BCR-ABL fusion genetypes are detected only by two differentupstream primers, a common downstream primer, a fluorescent labeled probe and a set of ABL internal reference gene detection system. With use of the specific primers and probes provided by the invention, the two fusion types of BCR-ABL can be detected only by one tube of a material, and the kit has the advantages of high specificity, good sensitivity and high accuracy.
Owner:DAAN GENE CO LTD

Method for assisting identifying chicken with different fat traits and primer special for same

The invention discloses a method for identifying chicken with different fat traits in an assisted manner and a primer special for the same. The method is characterized by detecting whether the nucleotide 301, from 5' terminal, of DNA shown in the sequence 3 in a sequence table in chromosome 1 of the chicken to be detected is T or C and determining whether the genetype of the chicken to be detected is TT, CT or CC, wherein the fat traits of the chicken with CC genetype are superior to the chicken with TT genetype and the chicken with CT genetype; the CC genetype is a homozygote with nucleotideat the site being C; the TT genetype is a homozygote with nucleotide at the site being T; and the CT genetype is a heterozygote of the CC genetype and the TT genetype. The method can assist screeningthe chicken with excellent fat traits (lower content of belly fat and simultaneously better growth conditions), has the advantages of quickness, simpleness and convenience and capability of screeningat early stage, has great significance in breeding the chicken and further has great significance in studying the mechanism of fat metabolism of the chicken.
Owner:CHINA AGRI UNIV

High-flux molecular marker for identifying pulp color of Cucumis melo L. and special primer for high-flux molecular marker

The invention discloses a high-flux molecular marker for identifying pulp color of Cucumis melo L. and a special primer for the high-flux molecular marker. The special primer disclosed by the invention is used for detecting a KASP primer for identifying a CmOr gene of the Cucumis melo L., and the specific nucleotide sequences of the specific primer are show in sequences 1 to 3 in a sequence table. A high-flux molecular marker system, based on a PCR (Polymerase Chain Reaction) SNP (Single Nucleotide Polymorphism) Line platform, which is provided by the invention is used for detecting a CmOr genetype of the Cucumis melo L., the operation flow is fully automatic, and artificial errors are reduced; the high-flux molecular marker is high in analysis flux and is very suitable for simultaneously detecting a large amount of samples. The molecular marker for high-flux detection is designed on the basis of a sequence of a color control gene CmOr of Cucumis melo L. and is applied to transformation breeding of color characters of the Cucumis melo L., so that the time and the labor cost can be greatly saved, the breeding efficiency of assisted selection of the molecular marker is improved, and transformation breeding of the pulp color of the Cucumis melo L. to an excellent skeleton inbred line is accelerated.
Owner:BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES

Molecular marker of gene for regulating gel consistency of rice and application thereof

The invention discloses a molecular marker of a gene for regulating gel consistency of rice and application thereof. The invention provides a method for identifying the rice with different gel consistency in an assisted manner, comprising the following steps: taking the genome DNA as a template and using WxM1 for PCR, determining the genetype of the rice as type I or type II if obtaining 252bp DNA and determining the genetype of the rice as type III if obtaining 275bp DNA; taking the genome DNA as a template, using WxM2 for PCR and Nhe I for enzyme digestion, determining the genetype of the rice as type I or type III if obtaining 1018bp DNA and determining the genetype of the rice as type II if obtaining 644bp and 374bp DNA; the gel consistency of the rice with genetype being type III being higher than that of the rice with genetype being type I and the gel consistency of the rice with genetype being type I being higher than that of the rice with genetype being type II; forming WxM1 by the DNAs shown in the sequences 1 and 2; and forming WxM2 by the DNAs shown in the sequences 3 and 4. The invention has important theoretical value and practice significance in rice quality improvement, has direct application value in purposefully improving the rice quality by utilizing the genetic engineering technology or using the molecular marker to assist breeding and has certain theoretical value in studying biosynthesis mechanism of plant starch.
Owner:INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI

Detection method and kit for coronary heart disease susceptibility loci rs1801133

The invention relates to a detection method and a kit for coronary heart disease susceptibility loci. The method comprises the following steps: (1) extracting a genome deoxyribonucleic acid (DNA) of a sample, and amplifying a region containing rs1801133 loci in a methylene tetrahydrofolate reductase (MTHFR) gene exon of the sample, so as to obtain an amplification product; (2) detecting the genetype of single nucleotide polymorphism (SNP) loci rs1801133 in the amplification product by using a high resolution melting (HRM) analysis technology. The genetype analysis is carried out on the region containing the rs1801133 loci in the amplified MTHFR gene by adopting the HRM analysis technology. The method is simple and quick to operate, low in use cost and accurate in result, and can achieve batch inspection; whether the tested people carry with coronary heart disease susceptibility genes can be clearly judged by using the kit, the coronary heart disease susceptibility people can be screened out from people, the poor living habit is improved, and the target of prevention is achieved.
Owner:光翰科技(上海)有限公司

Major quantitative trait locus for controlling fiber fineness of ramie, method and application thereof

The invention discloses a major quantitative trait locus SSR marker RAM0298 for controlling fiber fineness of ramie, and also discloses a method for obtaining the major quantitative trait locus for controlling fiber fineness of ramie. The method comprises the following steps: 1, ramie SSR marker genetype is obtained; 2, the SSR marker genetype is analyzed, and a K matrix graph is calculated; 3, a Q-value matrix is generated by the utilization of the SSR marker genetype; 4, by using the K matrix graph and the Q-value matrix as covariance, molecular marker data and fiber fineness quantitative character data are tested, and P and R2 data are output; 5, by using a PCA matrix and the K matrix graph as covariance, the molecular marker data and fiber fineness quantitative character data are tested, and P and R2 data are output; and 6, a SSR locus with P being less than 0.01 and R2 being greater than 0.20 is selected so as to obtain a major quantitative trait gene for controlling fiber fineness of ramie. The invention also discloses an application of RAM0298 in ramie variety breeding and fiber fineness enhancement.
Owner:INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI

Transforming growth factor-beta (TGF-beta) type I receptor gene of chlamys farreri and single nucleotide polymorphism (SNP) locus of TGF-beta type I receptor gene

The invention relates to the cloning of a transforming growth factor-beta (TGF-beta) superfamily type I receptor gene Tgfbrl1 of chlamys farreri in a molecular genetic marker technology, a screening and typing technology of a single nucleotide polymorphism (SNP) locus which is relevant with the weight of adductor muscles in the gene and a method for the application of the gene to the breeding of the high-yield chlamys farreri. A total-length complementary deoxyribonucleic acid (cDNA) sequence of the Tgfbr1 gene of the chlamys farreri is obtained by utilizing a homology-based cloning strategy; an SNP lotus is discovered by blastn comparison, and primers and a probe are designed for the locus; and SNP typing is performed in a natural population of the chlamys farreri by using a high-resolution melting curve technology, and the weight of the adductor muscle of an individual is measured. Statistic analysis displays that the loci c.1815C>T are obviously relevant with the weight of the adductor muscles of the chlamys farreri, and the weight of the adductor muscles of individuals with TT genetypes is obviously higher than that of the adductor muscles of individuals with CC and CT genetypes. In the selective breeding process of the high-yield chlamys farreri, the breeding candidate colonies of the chlamys farreri can be subjected to c.1815C>T typing, and the individuals of which the loci c.1815C>T are TT genetypes are used as a breeding parent preferably by combining typing information of other loci which are relevant with growth properties.
Owner:OCEAN UNIV OF CHINA

Molecular marker of gene for regulating gelatinization temperature of rice and application thereof

The invention discloses a molecular marker of a gene for regulating gelatinization temperature of rice and application thereof. The invention provides a method for identifying the rice with different gelatinization temperature in an assisted manner, comprising the following steps: taking the genome DNA of the rice to be tested as a template and carrying out PCR amplification by an SSII-3M1 primerpair; determining the genetype of the rice to be tested as type I if obtaining the 90bp DNA fragment; determining the genetype of the rice to be tested as type II if obtaining the 81bp DNA fragment; the alkali digestion value of the rice with genetype being type II being lower than that of the rice with genetype being type I; and forming the SSII-3M1 primer pair by the DNA shown in the sequence 1in the sequence table and the DNA shown in the sequence 2 in the sequence table. The invention has important theoretical value and practice significance in rice quality improvement, has direct application value in purposefully improving the rice quality by utilizing the genetic engineering technology or using the molecular marker to assist breeding and has certain theoretical value in studying biosynthesis mechanism of plant starch.
Owner:INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI

Molecular marker method for identifying rice heading date gene qHD7.4

The invention relates to a molecular marker method for identifying rice heading date gene qHD7.4, and belongs to the technical field of bioengineering. A pair of primers including a forward primer and a reverse primer are designed and synthesized, DNAs of different rice plants are amplified, and if a characteristic band of 117bp can be amplified, the rice plants are homozygote containing a normal heading gene qHD7.4, and if a characteristic band of 109bp can be amplified, the rice plants are homozygote of an early heading gene qhd7.4; if the characteristic band of 117bp and the characteristic band of 109bp exist simultaneously, the rice plants are heterozygote of the qHD7.4 and the qhd7.4. The method provided by the invention can quickly and accurately indentify whether the rice normal heading gene qHD7.4 or the early heading gene qhd7.4 exists in a rice germplasm resource and breeding populations thereof or not, and also can further distinguish the homozygote and heterozygote of qHD7.4, and predict progeny genetype, so as to greatly improve selection efficiency in the rice heading period, and accelerating breeding process.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES +1

Method for assisting in identifying sheep growth characters based on rs430810656 SNP locus

The invention discloses a method for assisting in identifying sheep growth characters based on an rs430810656 SNP locus. The method comprises the following step of detecting whether the genetype of the rs430810656 SNP locus in genome DNA of a sheep to be detected is AA genetype or GG genetype or GA genetype, wherein the growth character of the sheep with the AA genetype is superior to that of the sheep with the GA genetype, and the growth character of the sheep with the GA genetype is superior to that of the sheep with the GG genetype. The invention further provides a specific primer pair. The specific primer pair is composed of a primer F and a primer R which are as shown in a first sequence of a sequence list and a second sequence of the sequence list respectively. The method can be used for assisting in screening the sheep with good growth characters, has important significance in breeding of the sheep and has important significance in further research of the growth characters of the sheep.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

High-throughput molecular detection of Fusarium graminearum on carbendazim medicament-resistant gene frequency

The invention belongs to high-throughput molecular detection of Fusarium graminearum on carbendazim medicament-resistant gene frequency, which can be used for monitoring the medicament resistance of the Fusarium graminearum and early warning medicament-resistant epiphytotic disease of the Fusarium graminearum. The invention provides medicament-resistant high-throughput detection technology constructed based on the fact that over 97 percent of Fusarium graminearum medicament-resistant genetype to carbendazim results from mutation of the 167th locus of beta2-microtubulin gene. The detection method mainly comprises the following three steps of: (1) respectively extracting known sensitive and medicament-resistant strains and genome DNA of samples to be detected; (2) performing specific real-time quantitative PCR reaction and establishing a standard curve; and (3) contrasting the standard curve to solve the medicament-resistant gene frequency in the detected samples. The method has the characteristics of high throughput, rapidness and accuracy. The sensitivity of detecting the medicament-resistant gene frequency is millionth to one hundred thousandth, and the accuracy rate is over 96 percent.
Owner:NANJING AGRICULTURAL UNIVERSITY

Kit for identifying genetype of silky fowl skin color by detecting EDN3 (endothelin 3) gene copy number difference

The invention relates to a kit for identifying the genetype of a silky fowl skin color by detecting EDN3 (endothelin 3) gene copy number difference. The kit comprises a reference gene GAPDH (reduced glyceraldehyde-phosphate dehydrogenase) amplification primer (1), a target gene EDN3 amplification primer (2), calibration sample DNA (deoxyribonucleic acid) (3), fluorescent quantitative PCR (Polymerase Chain Reaction) reaction liquid (4) and double distilled water (5). The kit is characterized in that real-time fluorescent quantitative PCR reaction is carried out on a target gene EDN3 and a reference gene GAPDH by using the DNA of a tested sample as a template, Ct values are respectively recorded by using the calibration sample DNA as a reference, the EDN3 gene copy numbers of the tested sample are obtained by calculation, and further the Fm genetype of the silky fowl skin color is judged according to the EDN3 gene copy number difference. The operation of the kit does not need the establishment of a standard curve; the kit is simple, convenient, fast, good in repeatability and high in detection efficiency; and through chicken breed test-crossing testing, the method can accurately reflect the Fm homozygosis and heterozygosis of the skin color of the individual silky fowl. The detection method is conductive to acceleration of screening of homozygosity of the silky fowl skin color, guides target breeding of high-quality silky fowl new variety lines and provides reliable germplasm guarantee for follow-up commercialization mating hybridization.
Owner:HANGZHOU ACAD OF AGRI SCI

Culture medium for overcoming variety and genetype restriction in regeneration culture of alfalfa high frequency somatic embryos

InactiveCN101703002AOvercome different breedsOvercoming the genotype restriction problemHorticulture methodsPlant tissue cultureSucroseSaccharum
The invention discloses a culture medium for overcoming variety and genetype restriction in regeneration culture of alfalfa high frequency somatic embryos. The culture medium comprises seedling growth and acclimatization culture medium, a somatic cell embryo occurrence and induction culture medium, an embryo subgeneration formation culture medium and an embryo maturing and sprouting culture medium. The seedling growth and acclimatization culture medium is half modified MS+20g / L white sugar+0.7% agaragar; the somatic cell embryo occurrence and induction culture medium is modified SH+6-10mg / L2,4-D+0.2-0.5mg / L 6-BA+30g / L cane sugar+0.3% phytagel; the embryo subgeneration formation culture medium is modified SH+2-5 mg / L 2,4-D+0.2-0.5mg / L6-BA+500mg / L hydrolyzed casein+50g / L cane sugar+0.35% phytagel; and the embryo maturing and sprouting culture medium is modified MS+500mg / L hydrolyzed casein+30g / L white sugar+0.7% agaragar. The invention can effectively overcome the variety and genetype restriction in regeneration culture of alfalfa high frequency somatic embryos, vastly improve somatic cell embryo occurrence frequency and regeneration plant frequency, and enhance breeding efficiency.
Owner:JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY +1

Specific primer pair for detecting shrunken4 gene of corn and application of primer pair

The invention relates to a specific primer pair for detecting a shrunken4 gene of corn and application of the primer pair. The base sequences of a pair of specific primers Indel592, in the specific primer pair, for amplifying a left-side DNA segment of the shrunken4 gene are GGAAAGCGAAGCAGGTAA from the 5' end to the 3' end of the forward primer I, and GTGGCTCAATCTGGAAACAT from the 5' end to the 3' end of the reverse primer I; the base sequences of a pair of specific primers Indel575, in the specific primer pair, for amplifying a right-side DNA segment of the shrunken4 gene are CTGGGACTTCCTATGCCT from the 5' end to the 3'end of the forward primer II, and ACGGGAGATTTTGATTGAG from the 5' end to the 3' end of the reverse primer II. With the two molecular markers, genetype identification of DNA of any period and any tissue of corn can be realized, whether theshrunken4 gene exists in each single plant of a cross-breeding offspring exists or not and which state is the heterozygosis or isozygoty state can be detected. The detection method is high in accuracy, and simple to operate, and provides important technological means for DNA molecular marker assistant breeding of theshrunken4 gene.
Owner:SHANGHAI UNIV