238 results about "Sweet Peppers" patented technology

The present invention relates to preparation process of strain and preparation for controlling blight of vegetable biologically. One kind of Pseudomonas chlororaphis GP72 is cultured and screened with sweet pepper rhizoid and its attached soil sample and KMB culture medium with antibiotic added, and preserved in the number of CGMCC No. 1748. The freeze preserved strain is activated and amplifying cultured to obtain microbial preparation, which may be used for preventing and controlling blight of chili, cucumber, wax gourd, etc; for preventing and controlling rape sclerotinia rot, cucumber fusarium wilt, water melon fusarium wilt, etc; and as vegetable growth promoter to raise the yield of vegetable.

The invention provides seed and plants of pepper hybrid 9930417 and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of pepper hybrid 9930417 and the parent lines thereof, and to methods for producing a pepper plant produced by crossing such plants with themselves or with another pepper plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.

The invention provides seed and plants of pepper hybrid 9927864 and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of pepper hybrid 9927864 and the parent lines thereof, and to methods for producing a pepper plant produced by crossing such plants with themselves or with another pepper plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.

Hybrid pepper cultivar designated ‘E 499526’ which is a Sweetbite type and suitable for covered cultivation and open field, is disclosed. The invention relates to the seeds of hybrid pepper cultivar ‘E 499526’ and to the plants of hybrid pepper cultivar ‘E 499526’. The invention also relates to methods for producing a pepper plant, either inbred or hybrid, by crossing the hybrid cultivar ‘E 499526’ with itself or another pepper cultivar. The invention further relates to methods for producing other pepper cultivars derived from the hybrid ‘E 499526’.

The invention provides seed and plants of pepper hybrid 9941819 and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of pepper hybrid 9941819 and the parent lines thereof, and to methods for producing a pepper plant produced by crossing such plants with themselves or with another pepper plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.

The invention discloses an eight-ingredient porridge and a preparation method thereof. The eight-ingredient porridge is composed of millet, rice, corn, barley, mung bean, red bean, peanut, soybean, red date, celery cabbage, sweet pepper and carrot. Every 100g of eight-ingredient porridge respectively contains 7-8g of millet, 7-8g of rice, 7-8g of corn, 7-8g of barley, 7-8g of mung bean, 7-8g of red bean, 7-8g of peanut, 7-8g of soybean, 10-12g of celery cabbage, 10-12g of sweet pepper and 10-12g of carrot. The preparation process comprises the following steps: selecting, soaking, boiling, drying, pulverizing and the like. The instant vegetable eight-ingredient porridge disclosed by the invention has the advantages of abundant nutrition, high vitamin content and good mouthfeel and flavor, is hygienic and convenient to carry and eat, and is a natural healthy food without any pigment or preservative. The production technique has the advantages of simplicity, low production cost, and obvious economic and social benefits.

The invention provides seed and plants of the pepper line designated SBR28-1244. The invention thus relates to the plants, seeds and tissue cultures of pepper line SBR28-1244, and to methods for producing a pepper plant produced by crossing a plant of pepper line with itself or with another pepper plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of pepper line SBR28-1244, including the fruit and gametes of such plants.

The invention provides seed and plants of the pepper hybrid 9942815 and parents thereof. The invention thus relates to the plants, seeds and tissue cultures of such plants, and to methods for producing a pepper plant produced by crossing a plant provided with itself or with another pepper plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant, including the fruit and gametes of such plants.

The invention provides seed and plants of pepper hybrid 9927864 and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of pepper hybrid 9927864 and the parent lines thereof, and to methods for producing a pepper plant produced by crossing such plants with themselves or with another pepper plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of such plants, including the fruit and gametes of such plants.

The present invention discloses an iodine-chili planting method, which comprises the steps: 1) chili seeds with strong disease and stress resistance, excellent quality and high yields are chosen, and then dipped and germinated; 2) the germinated seeds are evenly scatter onto a seedling-raising bed, and the seedlings are separated when two euphylla are expanded; 3) after raising the seedlings for 60 to 80 days, the seedlings are fixedly planted; when the period of fruits bears, all branch buds under the sweet peppers are picked off; 4) basic fertilizers are sufficiently applied and the liquid iodine organic fertilizers are applied into the surface layers of the soils once before the seedlings of the chili are fixedly planted, or liquid iodine fertilizers are sprayed by stages before harvesting, as well as the prevention and cure of plant diseases and insect pests are needed to be done well. The iodine chili planed with the present invention are directly eaten as the natural sources of iodine needed by human beings, and meanwhile the background content of the iodine in the soils and ambient are increased, so as to gradually improve the ecological environment of iodine deficiency, thus promoting the content level of the iodine in food chain, especially having a profound meaning in eliminating IDD.

The present invention relates to a livestock and poultry feed, particularly to a green broiler feed with an effect of chicken quality improving. The feed is prepared from the following raw materials, by weight: 95-105 parts of corn, 15-20 parts of barley bran, 6-8 parts of shrimp bran, 10-12 parts of oat husk, 10-12 parts of vinegar lees, 15-18 parts of extruded soybean, 10-12 parts of sugarcane residue, 4-5 parts of pine needle powder, 2-3 parts of shell powder, 1-2 parts of talc powder, 2-3 parts of goose blood freeze-dried powder, 2-3 parts of fresh green tea leaf, 1-2 parts of earthworm powder, 1-2 parts of silkworm faeces, 6-8 parts of kalimeris indica, 2-3 parts of marigold petal powder, 2-3 parts of robinia pseudoacacia seed, 6-8 parts of sweet pepper, 1-2 parts of codonopsis pilosula powder, a proper amount of gravy salt, and 4-5 parts of a feeding attractant. According to the present invention, the feed has characteristics of rich raw materials, rich trace elements, effectively-improved chicken quality, improved slaughter rate, improved water holding capacity, reduced sebum thickness and reduced abdominal fat rate; and all the raw materials are pure nature green components, and the product quality is safe, and the feed has high market competitiveness.

The invention discloses a composite fermentation spice including tobacco leaf, trigonella foenum-graecum L., capsicum annuum and solanum lycopersicum and application thereof to a recombinant tobacco leaf. A strain is named raoultella planticola VP4-4 and is collected with the collection number CCTCC M 2012005, the full length of a 16SrRNA (16 ribosomal Ribonucleic Acid) sequence of the strain is 1,408bp, and the similarity between the 16SrRNA sequence and raoultella planticola is up to 99.563 percent. In a preparation method, a composite fermentation extract of extracts of tobacco leaf, trigonella foenum-graecum L., capsicum annuum and solanum lycopersicum is prepared from the strain by performing culture activation, preparation of a seed culture fluid, fermentation culture and transformation of a zymotic fluid. The fermentation spice is prepared from raw materials including original tobacco leaves of a cigarette product, a trigonella foenum spice which can be applied to cigarettes, capsicum annuum and solanum lycopersicum with a wide source, and has an industrial application prospect.

The invention provides seed and plants of the pepper line designated SBR28-1220. The invention thus relates to the plants, seeds and tissue cultures of pepper line SBR28-1220, and to methods for producing a pepper plant produced by crossing a plant of pepper line with itself or with another pepper plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of pepper line SBR28-1220, including the fruit and gametes of such plants.

The invention provides seed and plants of the pepper hybrid 9942595 and the parent lines thereof. The invention thus relates to the plants, seeds and tissue cultures of pepper hybrid 9942595 and the parent lines thereof, and to methods for producing a pepper plant produced by crossing such plants with themselves or with another pepper plant, such as a plant of another genotype. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts such plants, including the fruit and gametes of such plants.

This invention relates to the field of molecular markers, in particular to a molecular marker for aiding selection of a Rf (fertility restorer) gene, specific primers and an application. The genetic distance between the molecular marker and the Rf gene is 0.7cM, and the molecular marker is closely linked with the gene. Specific upstream and downstream primers of the molecular marker are as follows: the sequence of the upstream primer of MI16 is CCTCGAATATAAACTTATGGTGTCC, and the sequence of the downstream primer of MI16 is GCTTGGCAACCTATTCTTAGAAGTT. The M16 marker can quickly identify the Rf gene in a sweet pepper, and better complement the study of the sweet pepper in the direction of male sterility.

The invention discloses a creation method of sweet pepper SSR finger-print and an application thereof. The method is as follows: screening SSR primer for different sweet pepper varieties and inbred line total DNA to obtain 12 pairs of SSR polymorphism molecular markers, and performing electrophoretic separation to obtain corresponding SSR molecular marker polymorphism gram through the 12 pairs of SSR polymorphism molecular markers. The technology can make definite conclusion on the sweet pepper genetype, performs genetic classification to sweet pepper breeding material which is not recorded on an exact pedigree, makes up the deficiency of the pedigree record, also can be used for identifing the hereditary feature of the inbred line of sweet pepper, and protects the variety of the inbred line against invasion.

A method for production of sweet pepper hybrid seeds includes: A, making a male-female parent seedling bed; B, seeding for male and female parents at different stages, selecting female parent seeds from original Aidan 92-3-2 produced by Beijing seed company, and selecting male parent seeds from a self-selected yellow-shelled green pepper line 9808-8 produced by Deqing seeds and seedlings Co, Ltd.in Cixi city; C, transplanting seedlings into pots; D, performing field transplanting, and covering with black mulch to prevent grass damage; E, preparing before seed production, paring a land for weed removal once in April, and removing all first-generation flowers and fruits in early May when male parents of the sweet pepper blossom to bear fruits; F, collecting pollen of female parents; G, performing emasculation and pollination for the male parents; H, performing management after seed production, topping after five generations of fruit setting, applying compound fertilizer 20kg per mu by drip irrigation, and controlling greenhouse temperature to be between 22 DEG C and 28 DEG C; and I, harvesting. The sweet pepper seeds produced by the method are high in purity and good in quality, and benefits of per mu yield of sweet pepper planting can be improved greatly.

The invention relates to a preparation method of a fresh-keeping film with high carbon dioxide permeability and an application thereof on the preservation of fruits and vegetables. The prepration method of the film comprises the steps of: fully mixing polyethyleneimine water solution with polyvinyl alcohol water solution, then evenly coating the mixture on non-woven fabric and drying at specific temperature. The permeability coefficient of carbon dioxide of the prepared film is higher than 4 multiplied by 10<6>ml / m<2> d a tm, and the permeability ratio of carbon dioxide / oxygen is higher than 350. When in application, the prepared film is cut into small pieces according to needs, and the edges of the small films are thermally adhered on an ordinary polyethylene or polyvinyl chloride fresh-keeping bag to prepare a fresh-keeping bag with high carbon dioxide permeability. The fresh-keeping bag has obvious effects on the air conditioned preservation of the fruits and the vegetables which are vulnerable to the carbon dioxide, such as winter jujubes, pears, sweet pepper, Fuji apples and so on. The use of the fresh-keeping bag can reduce the carbon dioxide concentration in the fresh-keeping bag with the pears, winter jujubes and the like to be lower than 0.5 percent, thereby prolonging the shelf lives thereof and reducing the decay loss after the storage.

The invention discloses a sweet pepper sauce, which is prepared from the following components in part by weight: 8 to 20 parts of sweet pepper, 1 to 4 parts of sweet brown sauce, 1 to 5 parts of celery, 0.5 to 2 parts of bitter melon, 1 to 2 parts of edible oil, 0.1 to 0.8 part of white granulated sugar, 0.1 to 0.5 part of cooking wine, 0.03 to 0.08 part of seasoning, 0.2 to 0.5 part of edible salt and 0 to 0.01 part of star anise. The sweet pepper sauce not only has the characteristics of bright color, hot flavor and the like of a pepper sauce, but also is crisp, sweet, fragrant and hot to greatly increase appetite because of addition of the celery and the bitter melon. The sweet pepper sauce also has the health care function, can promote digestion and reduce blood pressure, and is suitable for both children and adults to frequently eat.

The invention relates to the technical field of foods, and aims to provide a roast meat seasoning sauce which is excellent in color, fragrance and taste and simple and rapid in a preparation method. The roast meat seasoning sauce disclosed by the invention is prepared from the following raw materials in percentage by weight: 25-38% of salad oil, 11-21% of a Pixian thick broad-bean sauce, 27-37% of a thick broad-bean sauce prepared with red oil, 1.0-2.0% of hot peppers prepared with fermented soya bean oil, 2.1-2.7% of cooking wine, 2.7-3.6% of a soy sauce, 1.6-2.4% of scallion ginger garlic powder, 0.6-1.0% of red pimiento powder, 1.3-1.9% of chicken essence, 0.2-0.4% of crushed black pepper granules, 5.5-7.1% of white sugar, 0.4-0.9% of pricklyash peel powder and 0.3-0.6% of cumin powder. The roast meat seasoning sauce disclosed by the invention not only is spicy and delicious in taste and ruddy in color, but also is high in nutrient value; the preparation method is simple and rapid, and easy to control, and the problems that the quality of a conventional roast meat sauce is instable and the conventional roast meat sauce is not suitable for batch production are solved; when meat is roasted, the roast meat seasoning sauce disclosed by the invention is added, the roasting process is simple, convenient and rapid, the mouth feel of the roast meat is better, the grade and the competitiveness of the roast meat are improved, and the roast meat seasoning sauce is suitable for vast crowds to eat.

The method of breeding sweet pepper hybrid with nuclear two-purpose male sterility line of sweet pepper features the breeding process, which includes the cross-breeding, selfing and sib breeding process to transfer the male sterile nuclear gene (msms) into selfing sweet pepper line with excellent agricultural character to obtain nuclear two-purpose male sterility line of sweet pepper of sterile plant rate of 50 %; the agricultural character selectivity of sib breeding for 2 or 3 generations to selectively breed the two-purpose male sterility line of sweet pepper with stable agricultural character, stable sterile plant rate of about 50 % and sterile degree of 100 %; culturing the hybrid seed with the sterile plants of the nuclear two-purpose male sterility line as female parent and the selfing line as male parent, removing the breeding plants before pollination and collecting seeds of the female parent. The present invention uses the nuclear male sterility line as both sterile line and maintainer line to simplify the breeding process.

The invention discloses an animal feed additive and a preparation method thereof. The additive comprises 20 g of codonopsis pilosula, 20 g of astragali radix, 10 g of malt, 10 g of fructus crataegi(stir-fried), 250 g of bean pulp, 250 g of cottonseed meal, 250 g of rapeseed meal, 100 g of sweet pepper pulp and 90 g of chrysanthemum powder. The preparation method of the additive comprises the following steps: firstly, conducting primary fermentation on the codonopsis pilosula, the astragali radix, the malt and the fructus crataegi(stir-fried) through using lactobacillus bulgaricus, wherein liquid fermentation is adopted in the primary fermentation, and the bacterium-inoculating amount is 20%; secondly, conducting secondary fermentation on the product subjected to the primary fermentation with 250 g of bean pulp, 250 g of cottonseed meal, 250 g of rapeseed meal, 100 g of sweet pepper pulp and 90 g of chrysanthemum powder through using saccharomycetes, so that a finished additive is obtained. According to the invention, effective ingredients in the traditional Chinese herbal medicines can be fully released during the primary fermentation; cellulose, protein and carbohydrates in the traditional Chinese herbal medicines and enriched plant materials can be resolved and converted during the secondary fermentation, as a result, rich organic acid and amino acid are produced, the nutrient content is further enriched, and the mouthfeel of the animal feed is better.

The invention relates to a processing method of pepper health seasoning oil with multiple flavors. The processing method comprises the following seven procedures: formulating a processing formula of seasoning oil, purchasing raw materials in classification, mixing and processing the raw materials according to a classification formula, extracting classification formula processing materials including aromatic oil, health oil and seasoning oil, mixing seasoning oil processed and extracted according to the classification formula into a multi-flavor composite health seasoning oil finished product, packaging the finished product, and carrying out constant temperature storage on the finished product in a warehouse. According to the processing method, base materials, aroma enhancement materials, health materials and multi-flavor materials are compounded according to multiple formulae, are uniformly mixed and are subjected to coarse powder processing, and effective components such as aromatic oil, health oil and seasoning oil in the seasoning materials are extracted in classification by virtue of an edible oil frying method, a water stream distillation method, a solvent oil extraction method and an oil press squeezing method and are mixed according to a certain ratio so as to obtain pure-flavor pepper health seasoning oil, spicy pepper health seasoning oil, pungent pepper health seasoning oil, fragrant-sweet pepper health seasoning oil, fragrant-sour pepper health seasoning oil and fragrant-salty pepper health seasoning oil.