78 results about "Reproductive capacity" patented technology

The present application relates to a SNP marker Ec62238 related to the reproductive traits of Exopalaemon modestus and an application thereof, and belongs to the technical field of crustacean genetics and breeding. Detection primers SEQ ID NO. 1-2 and typing primers SEQ ID NO. 3-5 are designed according to the SNP marker Ec62238. The gene sequence in which the SNP marker Ec62238 is located is shown in SEQ ID NO. 6. The base at the 601st site of the 5' end of the gene sequence is G or A. The SNP marker Ec62238 is located on the 24th chromosome of Exopalaemon modestus. The present application also provides an application of the detection primers and the typing primers in the selection of Exopalaemon modestus of good reproductive traits. The molecular marker is used for the screening of Exopalaemon modestus with high reproductive capacity or the selection of good breeds with high reproductive capacity, and can save cost and shorten the breeding period.

The invention relates to the technical field of livestock and poultry breeding, in particular to a goat hybridization breeding method capable of achieving complete-cycle nutrition enhancement. The core of the method is that systematic nutrition intervention runs through the whole breeding process. Before hybridization, performing differential nutrition pretreatment on the parents for 60 days: feeding the female parents with a breeding nutrition enhancer added with components such as D-chiro-inositol and N-acetylcysteine, and supplementing sperm motility enhancer containing acetylated L-carnitine and ergothioneine to the male parents. In the gamete treatment stage, the oocytes are subjected to in-vitro maturation culture in a special culture solution containing components such as D-chiro-inositol and a growth differentiation factor 9; after the sperms are subjected to gradient centrifugal screening, completing in-vitro fertilization in an optimized fertilization culture solution; after the embryos develop into blastocysts in the sequential culture system, carrying out laparoscopic transplantation, and carrying out staged precise nutrition culture on the pregnant ewes. According to the method, through multi-level nutrition enhancement, the reproductive capacity of the goats and the growth performance of offspring are effectively improved.

The application discloses Bifidobacterium Pseudocatenulatum and application thereof, and the Bifidobacterium Pseudocatenulatum YSBP01CCTCC NO: M 20232067. Experiments prove that the Bifidobacterium Pseudocatenulatum can enhance the antioxidant capacity of Caenorhabditis elegans, prolong the life of the nematode, improve the activity and the reproductive capacity of the nematode, reduce fat accumulation, improve the mitochondrial membrane potential, and delay the aging of the body. The Bifidobacterium Pseudocatenulatum can also significantly inhibit the weight increase of a high-fat-diet mouse, reduce the TG level in serum of the mouse, significantly reduce the fasting blood glucose concentration, and effectively prevent and relieve obesity and type 2 diabetes.

The invention provides an application of NUCB1 in reproductive capacity diagnosis and assisted reproductive evaluation, and particularly provides an application of an NUCB1 gene, mRNA, cDNA, protein or a detection reagent thereof. The invention finds for the first time that (1) the reproductive capacity of a mouse with NUCB1 gene deletion is lost or obviously reduced no matter whether the mouse is male or female; (2) during assisted reproduction, the superovulation capacity of the female rats is obviously reduced; therefore, the NUCB1 gene or the protein thereof can be (i) used as a marker for detecting and diagnosing reproductive capacity and (ii) used as a marker for judging female superovulation potential during assisted reproduction.

The invention belongs to the technical field of microorganisms, and particularly relates to a sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V, a fungicide and application of the fungicide. The invention provides a sclerotinia sclerotiorum pathopoiesis and reproduction dual deletion strain (Sclerotinia sclerotiorum) SD3-9V, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 2026255. The sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V provided by the invention has no pathogenicity, and sclerotium formation ability is deleted, so that the sclerotinia sclerotiorum can be used as a plant vaccine for preventing sclerotinia rot, and has multiple advantages of high biological safety, reduction of sclerotinia rot morbidity and promotion of crop growth and flowering. The invention provides an effective way for providing a safer and more reliable microbial agent for preventing and treating sclerotiniose.

The invention discloses plasmin based on hermetia illucens and application thereof, and belongs to the technical field of biology. The plasmin based on the hermetia illucens is obtained by grinding and centrifuging larvae of the hermetia illucens in a PBS (Phosphate Buffer Solution) and extracting supernate. The invention further provides application of the plasmin based on the hermetia illucens in preparation of thrombolytic drugs. The plasmin is extracted from the hermetia illucens, and the hermetia illucens is short in breeding cycle, high in reproductive capacity, capable of being massively extracted in a short time and low in cost; the extracted plasmin has a remarkable thrombolysis effect and has a very good utilization value; the plasmin can be used for directly dissolving thrombus and degrading fibrinogen.

This invention relates to the field of microbiology and discloses a strain of *Lactobacillus rhamnosus* and its applications. The *Lactobacillus rhamnosus* strain provided by this invention, with accession number CGMCC No. 33153, exhibits strong reproductive capacity and high production of lactic acid and hydrogen peroxide, demonstrating strong antibacterial properties. It has potential applications in organisms; it can regulate genes related to inflammation and apoptosis, thereby reducing the production of inflammatory factors and promoting cell growth and repair; it can also upregulate the gene expression of aquaporins and collagen, thereby promoting skin repair.

The application belongs to the technical field of pest control, and discloses application of a transcription factor CG17328 in control of drosophila melanogaster. The application discloses application of CG17328 in regulation of insect reproductive capacity. The application firstly screens a transcription factor for regulating the 'dumping' process of nurse cells in oogenesis of drosophila melanogaster by using transcriptome sequencing, genetics and molecular biology and other related technologies and means. The transcription factor is a ZAD-C2H2 type zinc finger protein CG17328. CG17328 is mainly located in the nuclei of nurse cells and oocytes in the late stage of oogenesis. CG17328 can affect the oogenesis process by regulating the 'dumping' process of nurse cells. The loss of CG17328 expression leads to significant decrease of the number of mature oocytes generated by ovaries and the hatching rate of eggs, which indicates that the loss or inhibition of CG17328 expression can achieve the control effect on drosophila melanogaster.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention relates to the field of biological prevention and control, in particular to a biological prevention and control method for spotted wing drosophila based on double-organism temperature control and a research method. The temperature for releasing the Pseudocera pupae is 18 DEG C. At 14 DEG C, no parasitic wasps emerge from the spotted wing drosophila melanogaster; the intrinsic growth rate and the periodontal growth rate of the pupa are obviously lower than those of the spotted wing drosophila at the same temperature; the optimal net parasitism rate, the weekly-limited parasitism rate and the stable parasitism rate of the Pachyrhizus pupae are observed at the temperature of 26 DEG C, but simulation data show that the number of the Pachyrhizus pupae populations can be remarkably reduced under the condition that damage is reduced by releasing a large number of Pachyrhizus pupae at the temperature of 18 DEG C; the high reproductive capacity of the Drosophila melanogaster at 22 DEG C and 26 DEG C obviously reduces the biological control efficiency of the Drosophila melanogaster, which indicates that more than thousands of times of parasitic wasps are needed and the control time is too late; and the long egg laying days and egg laying period at 18 DEG C are beneficial to the biological control efficiency.

The invention discloses an application of high-stress-resistance and high-pathogenicity Steinernemacarporapse XJ-39 nematode in prevention and treatment of Chinese chive maggots in arid and semi-arid regions, and provides a nematode strain S.carporapse XJ-39 which is high in pathogenicity to Chinese chive maggot pests, high in reproductive capacity and good in environmental adaptability at the same time. The corrected death rate of the Chinese chive maggots under the concentration of 150 IJs / larva reaches 75.55%; the number of live propagation nematodes of greater wax moths is 5.24 * 10 < 4 > IJs / larva and 2.10 * 10 < 4 > IJs / g; the death rate is 74.86% after treatment is conducted for 5 h at the temperature of 38 DEG C, and the death rate is only 23.64% after treatment is conducted for 4 h at the NaCl concentration of 10%; after being irradiated by 19W ultraviolet light for 4 hours, the death rate is 43.58%. The S.carpocapsae XJ-39 has good drought stress resistance, has relatively strong survivability under the humidity of a saturated solution of KCl and NaCl, and shows good compatibility with thiamethoxam. In the potting control effect, the control effect of mixed use of nematodes and thiamethoxam reaches 80% or above; after the pesticide is applied in the field, the correction control effect on Chinese chive maggots is 70.25%-60.24%, and the pesticide has fast-acting property and persistent effect. According to the technical scheme provided by the invention, healthy planting, sustainable and high-quality development of the Chinese chives in the arid and semi-arid regions can be further assisted.

The application discloses a device for breeding good species of crayfish and application thereof, and the device comprises a population selection unit and a family selection unit; the population selection unit is a cuboid in overall structure, and comprises a population selection water tank, a population selection crayfish tank and a crayfish nest; the population selection crayfish tank is detachably embedded in the population selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the population selection crayfish tank and the population selection water tank; the family selection unit is a cylinder in overall structure, and comprises a family selection water tank, a family selection crayfish tank and a crayfish nest; the family selection crayfish tank is detachably embedded in the family selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the family selection crayfish tank and the family selection water tank. Advantages of the device are as follows: the device utilizes the self behavior characteristics and external nest position advantages of crayfish to first breed parent individuals with strong bodies and strong resistance, and then remove the nest position advantages to breed individuals with strong reproductive capacity; and the device can obtain crayfish parents with stable genetic traits.

The present invention relates to a composition for improving the reproductive capacity of a livestock, which can improve productivity by improving the reproductive capacity of the livestock, prevent various problems that may be caused by abuse of a hormone preparation, and can reduce the economic burden (e.g., feed cost) of a feeder.

The invention relates to a compound microbial agent and application thereof, belongs to the technical field of microorganisms, and particularly discloses application of mixed fermented milk in a product for improving male functions. According to the application, the new application of the mixed fermented milk of the rhamnosus lactobacillus B6 and the streptococcus thermophilus XJ53 (CGMCC No.17323) in the aspect of improving male functions is disclosed for the first time, and the new application is specifically characterized by improving male fertility desire, reproductive capacity, seminiferous tubule dysfunction and spermatogenesis, testis oxidative stress activity, testis testosterone synthesis and sperm quality; the strain has a potential value of producing a gain substance for improving the male function by fermenting skimmed milk, and also prompts that the fermented milk has a potential application prospect for enhancing the male function.

The present application relates to a kind of sphingosine purposes, kit, the method for detecting the reproductive capacity of male mammal and device and the method for screening ram, and sphingosine is used as the reproductive capacity marker of male mammal;The method for detecting the reproductive capacity of male mammal includes: the content of sphingosine in the sample to be measured is detected, and based on the content of the sphingosine, the reproductive capacity of the animal corresponding to the sample to be measured is determined.Sphingosine is used as marker, the reproductive capacity of male mammal can be directly judged, and it is helpful to screen out the male mammal of high reproductive capacity as paternal line to reproduce, and the reproduction rate of animal can be improved.

The invention belongs to the technical field of biology, and particularly discloses a dsSAM50 / dsActin-coated MSNs nano-complex, a preparation method thereof and application of the dsSAM50 / dsActin-coated MSNs nano-complex in prevention and control of large thrips of cowpeas, dsSAM50 and dsActin are simultaneously loaded by adopting nano-carrier mesoporous silica nanoparticles (MSNs), double genes (dsSAM50 / dsActin) are loaded through the mesoporous silica nanoparticles (MSNs), and the dsSAM50 / dsActin-coated MSNs nano-complex is obtained through the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex and the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex. The technical bottlenecks that bare dsRNA is easy to degrade and low in delivery efficiency in the traditional RNAi technology are broken through. The complex significantly improves the cell delivery efficiency of lethal genes by virtue of the high load capacity and targeted release characteristic of the nano-material, not only can significantly inhibit the expression of SAM50 and Actin genes of the megalurothrips megalurothrips, but also can significantly reduce the fecundity of the megalurothrips megalurothrips, significantly improves the death rate of the megalurothrips megalurothrips, and has good application prospects. After the two dsRNAs and the MSNs form a complex, the control effect on the cowpea large thrips can be improved.

The application discloses a bacteria with limited reproduction capacity, a method for controlling bacterial reproduction and application, and belongs to the technical field of biotechnology and cell immunotherapy. The bacterial DNA comprises an unnatural amino acid orthogonal translation module, a suicide module and a rescue module. Based on the unnatural amino acid (ncAA) orthogonal translation system, the orthogonal genetic barrier theory is used, gene circuit design and element modularization are used, bacterial reproduction generations are accurately controlled, bacterial growth is effectively controlled, and the bacteria are prevented from escaping, and the bacteria have wide applicability. The bacteria and the method have wide application prospects in the development of attenuated live vaccines.

The invention belongs to the technical field of microorganisms, and particularly discloses application of lactobacillus rhamnosus fermented milk in a product for improving male functions. According to the application, the new application of the lactobacillus rhamnosus B6 (CGMCC No.13310) fermented milk in the aspect of improving male functions is disclosed for the first time, and the new application is specifically characterized by improving male fertility desire, reproductive capacity, seminiferous tubule dysfunction and spermatogenesis, testis oxidative stress activity, testis testosterone synthesis and sperm quality; the strain has a potential value of producing a gain substance for improving the male function by fermenting skimmed milk, and also prompts that the fermented milk has a potential application prospect for enhancing the male function.

The application discloses a kind of built-in anti-ejaculation devices of stallion, it is related to the technical field of animal husbandry, including placing hose, support tube is placed in the inside of placing hose;The outer side wall of the open end of support tube is installed with snap ring, and the opposite surface of snap ring is installed with fixed assembly;One of snap ring is in abutment with the inner side wall of placing hose, and the other snap ring is in abutment with the opening of placing hose.The application discloses a kind of built-in anti-ejaculation devices of stallion, not only can realize the filtration of sperm of stallion, but also can make that tissue fluid can normally flow and avoid vas deferens congestion, and will not affect normal mating behavior of stallion, further, anti-ejaculation behavior is reversible, does not affect stallion recovery reproductive capacity in later period, overall built-in structure design is compact, fixed assembly is assembled firmly, can be long-term retained and used, no exposed component, safe and non-irritating, adapt to stallion physiological structure, and practicality is strong.

The invention discloses an mRNA vaccine for regulating and controlling the reproductive capacity of animals and application of the mRNA vaccine, the antigen of the mRNA vaccine is a GnRH fusion protein antigen formed by coupling GnRH and Fc protein or Flden protein, the immunogenicity and stability of GnRH are improved, and experiments prove that the prepared mRNA vaccine can well control the level of sex hormones so as to regulate and control the reproductive capacity of the animals, so that the animal reproductive capacity can be regulated and controlled. The safety is good; experiments further show that the level of antibodies induced by the GnRH-Fc mRNA vaccine is higher than that of a GnRH-Folden mRNA vaccine group, and the GnRH-Fc mRNA vaccine can reduce the hormone level more effectively compared with the GnRH-Folden mRNA vaccine, so that the reproductive capacity of animals can be better controlled.

The present invention provides a method for breeding broodstock of whiteleg shrimp, which comprises screening healthy broodstock free of specific pathogens, grading them according to growth rate, body shape and reproductive capacity, and breeding them in an optimized breeding environment, including precise control of water temperature, salinity and feed ratio, obtaining shrimp seedlings through regular health monitoring and genetic trait recording, combining artificial insemination or natural breeding, and screening for genetic traits. After the shrimp seedlings are cultivated to the P10 stage, they are screened again through cage grading to ensure that the shrimp seedlings are of consistent specifications. High-quality broodstock are used for the next generation of breeding, forming a closed-loop breeding system. In addition, an animal model is established through computer software, the growth traits of the family are evaluated, and the breeding plan is continuously optimized. This method ensures the genetic advantage and health status of the broodstock by comprehensively using biostatistics, molecular marker technology and morphological and physiological evaluation, providing an efficient and sustainable broodstock breeding strategy for the whiteleg shrimp farming industry.

The invention relates to a goat fecundity-related SMAD4 gene SNP molecular marker, a primer pair, a kit and application thereof, and belongs to the technical field of goat breeding. The SNP molecular marker is located at the g.50731937 site of the SMAD4 gene, and the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1; a / C mutation exists at the 45bp position from the 5'end of the SNP molecular marker. By analyzing the goat SMAD4 gene, it is found for the first time that the gene region has a g.50731937 site, and the SNP molecular marker is significantly related to the goat reproductive capacity character. The SNP locus is obviously and positively correlated with the goat reproductive capacity character, particularly the first-birth lambing number of the goat, and can be used as a molecular marker for identifying the goat reproductive capacity character, so that early selection of the reproductive character is realized, and the breeding cycle is shortened by at least 2-3 years compared with a traditional method depending on lambing recording. In addition, after goats with high reproductive capacity characters are identified, the goats can be used for breeding the goats, and the effect and the purpose of improving breeding are achieved.

The invention discloses an application of curcumin in improving puberty male reproductive capacity damage caused by chemotherapeutic drugs. Aiming at the problems of testicular germ cell quantity reduction, oxidative stress injury, long-term fertility damage and the like caused by cytosine arabinoside chemotherapy, curcumin is applied while or before the cytosine arabinoside is applied. The application is realized through combined administration or a pharmaceutical composition containing curcumin and cytarabine. Experiments show that the scheme can effectively relieve testicular tissue form damage, reduce germ cell apoptosis and antagonize oxidative stress, and significantly improve the sperm quality of adult individuals. The invention provides a new potential strategy for synchronously protecting the reproductive function of a clinical child tumor patient during chemotherapy.

The invention provides a biological preparation for regulating animal reproductive capacity, and belongs to the technical field of animal medicine. The biological preparation consists of a sipunculus nudus peptide-fucoidin compound and a pharmaceutically acceptable carrier. Wherein the sipunculus nudus peptide is extracted from sipunculus nudus through enzymolysis and ultrafiltration technologies, and then the sipunculus nudus peptide and the fucoidin are prepared into the compound according to a specific proportion. Researches show that the compound can significantly inhibit premature onset of meiosis of oocytes and has an obvious synergistic effect, the in-vitro maturation rate of the oocytes is increased from 62.94% to 91.12%, and the blastocyst formation rate is increased from 43.44% to 62.21%. By optimizing the quality of the oocytes, the in-vitro maturation and embryonic development capabilities of the oocytes are remarkably improved, and an efficient and safe novel biological preparation is provided for a breeding technology in the fields of animal husbandry and animal medicine.

The invention provides a method for predicting the population development trend of field rice planthoppers by utilizing microorganisms of immigrated adults for the field of agricultural pests, which is characterized by comprising the following steps: collecting the immigrated adults of the rice planthoppers, and measuring the diversity and relative abundance of the microorganisms carried in the adults; establishing a relation model between the diversity and relative abundance of the microbiota and the life, fecundity and progeny short wing rate of immigrated adults; carrying out microbiota determination on rice planthopper adults of an immigration peak to be predicted to obtain diversity and relative abundance indexes, substituting the diversity and relative abundance indexes into the relation model, and predicting the life, the fecundity and the progeny short wing rate of the rice planthopper adults of the immigration peak; the development trend of the population is predicted when the rice planthoppers migrate according to the standard that the longer the imago life is, the higher the reproductive capacity or the short wing rate of the progeny is, the faster the subsequent number increase of the field rice planthopper population is, the higher the number is, and the heavier the harm is, and the development trend of the population is predicted when the rice planthoppers migrate into the rice planthoppers.

The present application relates to a method for increasing the reproductive capacity of Sirex noctilio by water bath treatment of Tenebrio molitor pupae, which comprises preparing a series of necessary materials and equipment, including Tenebrio molitor larvae, culture dishes, absorbent paper, glass pipettes, etc., and then feeding Tenebrio molitor under suitable conditions until pupation. Next, select Tenebrio molitor pupae that have not been hatched for more than 48 hours and have similar quality, and then perform constant temperature water bath treatment at 30 DEG C for 3 minutes to improve their physiological state. The treated Tenebrio molitor pupae are used as parasitic hosts of Sirex noctilio, and the method effectively increases the parasitization rate and success rate of Sirex noctilio on the alternative host Tenebrio molitor pupae, provides high-quality parasitic wasp resources for biological control, helps to reduce the use of chemical pesticides, protects the ecological environment, and realizes the sustainable development of agriculture and forestry.

A regulation method for the gonadal development in Acipenser sinensis broodfish. The regulation process comprises the following steps: 1) at a daily feeding amount of 0.5-1.0% and a daily feeding frequency of 2 times / day, carrying out gonadal activation cultivation on Acipenser sinensis broodfish at stage II of gonadal development, to obtain broodfish at stage III of gonadal development; 2) at the daily feeding amount of 0.5-1.0%, the daily feeding frequency of 2 times / day, and a noise limit in aquaculture environment of 60 dB, carrying out near-maturation cultivation on the broodfish at stage III of gonadal development, to obtain broodfish at the early stage IV of gonadal development; and 3) carrying out reduced-feeding cultivation on the broodfish at the early stage IV of gonadal development, to obtain broodfish having reproductive capacity. By using the regulation method provided in the present application, the gonadal activation rate of the Acipenser sinensis broodfish can be effectively increased, and refined cultivation is carried out on key Acipenser sinensis broodfish at stage III of gonadal development, to regulate the normal gonadal development of the key Acipenser sinensis broodfish to enter stage IV and achieve maturation.

The present invention relates to a composition for improving the reproductive ability of livestock, and can enhance productivity through improved reproductive ability of livestock and prevent various problems that may arise from indiscriminate use of hormonal preparations, and can alleviate economic burden of breeders, such as feed costs.

The present invention relates to a method for controlling a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crops, wherein (i) either a composition containing one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils (Curculionidae), in particular beet weevils (sugar beet weevil; Asproarthenis punctiventris), is applied to an agricultural area;or (ii) a composition comprising one or more types of nucleic acid molecules, in particular RNAi molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils, applied to trap plant strips at the edge of, within and / or around the agricultural area, wherein these trap plant strips are sown with a trap plant density of at least 50 plants / m2; such that the weevils, in particular the beet weevils, come into contact with the nucleic acid molecules, in particular the RNAi molecules, so that the development, reproductive capacity or viability of the weevils is inhibited.;

The present invention relates to a method for controlling a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crop plants, wherein: (i) either a composition comprising one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive ability or survivability of weevils (Curculionidae), in particular beet weevils (sugar beet weevils; Asproparthenis punctiventris), is applied to an area of agricultural land; or (ii) a composition which comprises one or more types of nucleic acid molecules, in particular of RNAi molecules, which inhibit the metabolism, the development, reproductive capacity or survivability of weevils, is applied to bait-plant strips at the edge of, in and / or around the area of agricultural land, wherein these bait-plant strips are sown with a bait-plant density of at least 50 plants / m2; such that the weevils, in particular the beet weevils, come into contact with the nucleic acid molecules, in particular the RNAi molecules, such that the development, reproductive capacity or survivability of the weevils is inhibited.