111 results about "Reproductive capacity" patented technology

The invention provides application of dsRNA in inhibition of reproductive capacity of bemisia tabaci, and belongs to the technical field of pesticides. The dsRNA is one or more of dsBtInR1 and dsBtInR2, and the dsRNA is one or more of dsBtInR1 and dsBtInR2. According to the invention, two bemisia tabaci insulin receptor genes BtInR1 and BtInR2 are found, and after the expression levels of BtInR1 and BtInR2 in bemisia tabaci are knocked down, a JH signal channel can be influenced by interfering an insulin signal channel, and finally, the reproductive capacity of the bemisia tabaci is inhibited, so that a theoretical and application basis is provided for developing and producing green biopesticide for preventing and treating the bemisia tabaci.

The invention discloses a culture method for improving the reproductive capacity of indigenous nematodes and application of the culture method, and belongs to the technical field of indigenous nematode culture. According to the present invention, the Rosselomyces aquimaris L-3 strain is the indigenous nematode intestinal tract strain, is the new strain, can enrich the nutrition source of the indigenous nematode, can significantly improve the egg laying amount of the nematode fed with the strain in the early stage of the breeding period, and can improve the egg laying amount by 36.3% compared with the currently common E. coli OP50 bacteria, and can not produce any harm to the indigenous nematode; the provided culture method is convenient and efficient, the breeding speed of indigenous nematodes can be remarkably increased under the laboratory environment condition by adopting the culture method provided by the invention, and compared with the currently common E. coli OP50 bacteria, the extremely remarkable difference can be achieved in the second breeding day, the necessary nematode number can be provided for short-period experiments, and the related research process can be accelerated.

The invention discloses a vibration signal synthesis method for interfering the mating behavior of Liriomyza trifoliate, which can effectively trigger resonance on leaves and interfere natural vibration signals of Liriomyza trifoliate by playing artificially synthesized vibration signals with frequencies similar to those of Liriomyza trifoliate courtship signals, so that the communication between male and female is submerged, and the mating behavior of Liriomyza trifoliate is inhibited. The method has the advantages of preventing the pests from smoothly completing the mating process, utilizing the synthesis and transmission technology of the vibration signals, having remarkable advantages, not only effectively reducing the population reproductive capacity of the pests, but also avoiding the problems of environmental pollution and pest resistance of insecticides, and being a sustainable solution for agricultural pest prevention and control in the future.

The invention relates to the field of agricultural pest vibration interference prevention and control, and particularly provides a method for interfering the mating behavior of vegetable leafminers by using artificially synthesized vibration signals. According to the method, vibration signals similar to vegetable leafminer courtship signals are accurately synthesized, and natural courtship behaviors are interfered through leaf surface propagation. By adjusting the frequency, the amplitude, the duration and the signal interval of the artificial vibration signal, leaf resonance can be effectively triggered, so that the duplication communication of the male and female liriomyza sativae is interfered, the male and female liriomyza sativae is prevented from successfully completing mating, the population reproductive capacity is remarkably reduced, and the crop damage is further reduced.

The invention discloses a method for constructing an Asiatic corn borer GBP gene homozygous mutant, which comprises the following steps: amplifying and cloning an Asiatic corn borer GBP gene sequence by using RACE technology, and the nucleotide sequence of the Asiatic corn borer GBP gene is as shown in SEQ ID No.1; two sgRNA target sequences are designed on a second exon of a GBP gene sequence of the ostrinia furnacalis, target sgRNA is synthesized through in-vitro transcription, the target sgRNA and Cas9 protein are fused in vitro to form an RNP mixture, and the RNP mixture is injected into ovum of the ostrinia furnacalis; the method comprises the following steps: carrying out PCR (Polymerase Chain Reaction) amplification on a target spot by using a target spot detection primer, sequencing to confirm a mutant individual, hybridizing and selfing to obtain a GBP homozygous mutant population. The Asiatic corn borer GBP gene homozygous mutant is constructed, so that the reproduction and immune functions of the mutant are remarkably reduced, and reference and research basis are provided for later development and formation of efficient pest biopesticide.

The invention discloses a breeding and maturing method of Sichuan parabramis pekinensis parent fish, which comprises the following steps: putting male and female parabramis pekinensis into a breeding pond with the putting density of 150 parabramis pekinensis / m < 2 >; the tubificidae and the sturgeon special feed are uniformly mixed for domestication, the weight ratio of the tubificidae to the sturgeon special feed is 8: 2, and an artificial nutrition feed additive is supplemented; 7-10 days before spawning induction, feeding is stopped; feeding management: the dissolved oxygen in the culture water is greater than 6mg / L, the average water temperature is 23 DEG C, and the pH value is 6.5-7.5; disinfecting the parent fish culture pond every other January; water flow stimulation: adjusting the water flow speed to 0.04 m / s; in the close breeding period, a rainfall temperature increasing and water flow stimulation combined mode is adopted, and water surface and underwater combined mode is adopted for water flow stimulation. According to the method, through artificial regulation and control, the female and male Sichuan parabramis pekinensis parent fishes are mature, the brood amount is large, the reproductive capacity is high, the sperm and egg quality is high, and synchronous maturation of the female and male parent fishes is achieved.

The invention provides a reproduction-promoting replacement gilt compound feed as well as a preparation method and application thereof. The reproduction-promoting replacement gilt compound feed comprises the following components in parts by weight: 80-110 parts of a base material, 1-2 parts of calcium salt, 1-3 parts of a functional additive and 1-2 parts of a premix, the functional additive is prepared from the following components in parts by weight: 10 to 30 parts of plant extract, 0.01 to 0.1 part of punicalagin and 0.01 to 0.1 part of asperuloside. The replacement gilt compound feed provided by the invention can stimulate the reproductive system of a replacement gilt to rapidly mature, remove excessive free radicals generated by the body, maintain the balance of an oxidation-reduction system in the body, avoid oxidative stress damage to the reproductive system of the replacement gilt, start the puberty period of the replacement gilt in time, promote the replacement gilt to oestrus, and improve the survival rate of the replacement gilt. The reproductive capacity of the replacement gilts is improved.

The present application relates to a SNP marker Ec62238 related to the reproductive traits of Exopalaemon modestus and an application thereof, and belongs to the technical field of crustacean genetics and breeding. Detection primers SEQ ID NO. 1-2 and typing primers SEQ ID NO. 3-5 are designed according to the SNP marker Ec62238. The gene sequence in which the SNP marker Ec62238 is located is shown in SEQ ID NO. 6. The base at the 601st site of the 5' end of the gene sequence is G or A. The SNP marker Ec62238 is located on the 24th chromosome of Exopalaemon modestus. The present application also provides an application of the detection primers and the typing primers in the selection of Exopalaemon modestus of good reproductive traits. The molecular marker is used for the screening of Exopalaemon modestus with high reproductive capacity or the selection of good breeds with high reproductive capacity, and can save cost and shorten the breeding period.

The invention relates to the technical field of livestock and poultry breeding, in particular to a goat hybridization breeding method capable of achieving complete-cycle nutrition enhancement. The core of the method is that systematic nutrition intervention runs through the whole breeding process. Before hybridization, performing differential nutrition pretreatment on the parents for 60 days: feeding the female parents with a breeding nutrition enhancer added with components such as D-chiro-inositol and N-acetylcysteine, and supplementing sperm motility enhancer containing acetylated L-carnitine and ergothioneine to the male parents. In the gamete treatment stage, the oocytes are subjected to in-vitro maturation culture in a special culture solution containing components such as D-chiro-inositol and a growth differentiation factor 9; after the sperms are subjected to gradient centrifugal screening, completing in-vitro fertilization in an optimized fertilization culture solution; after the embryos develop into blastocysts in the sequential culture system, carrying out laparoscopic transplantation, and carrying out staged precise nutrition culture on the pregnant ewes. According to the method, through multi-level nutrition enhancement, the reproductive capacity of the goats and the growth performance of offspring are effectively improved.

The invention provides a simple device for storing and transporting frozen sperms of male horses, and relates to the technical field of sperm freezing. The simple device for storing and transporting frozen semen of the male horses comprises a device box and four storage pipes, a top plate is fixedly arranged at the position, close to the rear end, of the upper end face of the device box, an electric guide rail is embedded in the lower end of the top plate, a first electric push rod is slidably arranged in the electric guide rail, and a moving plate is fixedly arranged at the lower end of the first electric push rod; clamping assemblies are arranged on the lower portions of the two sides of the moving plate in a penetrating mode, a freezing box is fixedly arranged on the upper portion of the front end face of the device box, a containing groove is formed in the middle of the upper end face of the device box, and rotating plates are hinged to the upper portions of the two sides of the interior of the containing groove. According to the horse semen freezing and storing device, the horse semen is more convenient to place and more stable when being frozen and stored, mass damage caused by shaking is not likely to happen, manual taking and placing are not needed, bacterium breeding is reduced, therefore, the quality of the semen is guaranteed, and the reproductive capacity of a male horse is improved.

The invention relates to a double-network immobilization carrier of coral symbiotic zooxanthellae and a preparation method, and belongs to the technical field of marine organisms, the carrier is specially designed for zooxanthellae so as to improve the biological activity of zooxanthellae and increase the reproductive capacity of zooxanthellae. The carrier prepared by the method not only can ensure rapid propagation of zooxanthellae in a marine environment and establishment of an efficient symbiotic relationship with madrepore, but also can provide required moisture and nutrition for growth of zooxanthellae. A good affinity effect can be formed between the carrier and zooxanthellae, and the carrier has high biocompatibility. And secondly, the carrier also has excellent tolerance, can keep stability in a severe marine environment, and resists the influence of stormy waves and salinity change. In addition, the carrier not only can protect the zooxanthellae and promote the growth of the zooxanthellae, but also can enhance the resilience and sustainability of the coral reef ecological system.

The application discloses Bifidobacterium Pseudocatenulatum and application thereof, and the Bifidobacterium Pseudocatenulatum YSBP01CCTCC NO: M 20232067. Experiments prove that the Bifidobacterium Pseudocatenulatum can enhance the antioxidant capacity of Caenorhabditis elegans, prolong the life of the nematode, improve the activity and the reproductive capacity of the nematode, reduce fat accumulation, improve the mitochondrial membrane potential, and delay the aging of the body. The Bifidobacterium Pseudocatenulatum can also significantly inhibit the weight increase of a high-fat-diet mouse, reduce the TG level in serum of the mouse, significantly reduce the fasting blood glucose concentration, and effectively prevent and relieve obesity and type 2 diabetes.

The invention provides an application of NUCB1 in reproductive capacity diagnosis and assisted reproductive evaluation, and particularly provides an application of an NUCB1 gene, mRNA, cDNA, protein or a detection reagent thereof. The invention finds for the first time that (1) the reproductive capacity of a mouse with NUCB1 gene deletion is lost or obviously reduced no matter whether the mouse is male or female; (2) during assisted reproduction, the superovulation capacity of the female rats is obviously reduced; therefore, the NUCB1 gene or the protein thereof can be (i) used as a marker for detecting and diagnosing reproductive capacity and (ii) used as a marker for judging female superovulation potential during assisted reproduction.

The invention belongs to the technical field of microorganisms, and particularly relates to a sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V, a fungicide and application of the fungicide. The invention provides a sclerotinia sclerotiorum pathopoiesis and reproduction dual deletion strain (Sclerotinia sclerotiorum) SD3-9V, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 2026255. The sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V provided by the invention has no pathogenicity, and sclerotium formation ability is deleted, so that the sclerotinia sclerotiorum can be used as a plant vaccine for preventing sclerotinia rot, and has multiple advantages of high biological safety, reduction of sclerotinia rot morbidity and promotion of crop growth and flowering. The invention provides an effective way for providing a safer and more reliable microbial agent for preventing and treating sclerotiniose.

The invention provides an application of a brown planthopper target sequence Nl14 in improving resistance of rice to brown planthopper and a method thereof, the rice can silence the function of the brown planthopper target sequence Nl14 shown in a nucleotide sequence such as SEQ ID NO.2 by utilizing a plant-mediated RNA interference technology, and the survival rate, growth and development speed and reproductive capacity of brown planthopper on the rice are remarkably reduced; therefore, the resistance of the rice to the brown planthopper is improved. The method is environment-friendly and economical, has a lasting insect-resistant effect, and is expected to provide powerful guarantee for sustainable production of rice.

The invention provides a traditional Chinese medicine formula for improving male horse fecundity, and relates to the technical field of additives. The traditional Chinese medicine formula for improving the reproductive capacity of the male horses specifically comprises the following components in parts by weight: 10-15 parts of cherry leaves; 5-7 parts of cherry tree roots; 10-20 parts of Chinese wolfberry fruits; 5-10 parts of beautiful millettia root; 5-10 parts of eucommia ulmoides; 15 to 30 parts of actinolite; 15 to 30 parts of actinolitum brevifolium; 10 to 15 parts of Angora bark; 6-10 parts of cynomorium songaricum powder; 11 to 16 parts of herba epimedii; 8-10 parts of honey; 5 to 6 parts of melatonin; 6-8 parts of organic zinc; comprising an additive, wherein the component amount of the carrier is 200-300 parts. By reasonably selecting traditional Chinese herbal medicines and adding byproducts, the semen quality and ejaculation amount of male horses can be remarkably improved, the breeding capacity is enhanced, the composition has the characteristics of wide source, diversified functions, no residue, no toxic or side effect and the like, meanwhile, the composition is precise and appropriate in compatibility and exerts a synergistic effect, and the efficacy activity is obviously superior to that of each single component.

The invention discloses plasmin based on hermetia illucens and application thereof, and belongs to the technical field of biology. The plasmin based on the hermetia illucens is obtained by grinding and centrifuging larvae of the hermetia illucens in a PBS (Phosphate Buffer Solution) and extracting supernate. The invention further provides application of the plasmin based on the hermetia illucens in preparation of thrombolytic drugs. The plasmin is extracted from the hermetia illucens, and the hermetia illucens is short in breeding cycle, high in reproductive capacity, capable of being massively extracted in a short time and low in cost; the extracted plasmin has a remarkable thrombolysis effect and has a very good utilization value; the plasmin can be used for directly dissolving thrombus and degrading fibrinogen.

This invention relates to the field of microbiology and discloses a strain of *Lactobacillus rhamnosus* and its applications. The *Lactobacillus rhamnosus* strain provided by this invention, with accession number CGMCC No. 33153, exhibits strong reproductive capacity and high production of lactic acid and hydrogen peroxide, demonstrating strong antibacterial properties. It has potential applications in organisms; it can regulate genes related to inflammation and apoptosis, thereby reducing the production of inflammatory factors and promoting cell growth and repair; it can also upregulate the gene expression of aquaporins and collagen, thereby promoting skin repair.

The application belongs to the technical field of pest control, and discloses application of a transcription factor CG17328 in control of drosophila melanogaster. The application discloses application of CG17328 in regulation of insect reproductive capacity. The application firstly screens a transcription factor for regulating the 'dumping' process of nurse cells in oogenesis of drosophila melanogaster by using transcriptome sequencing, genetics and molecular biology and other related technologies and means. The transcription factor is a ZAD-C2H2 type zinc finger protein CG17328. CG17328 is mainly located in the nuclei of nurse cells and oocytes in the late stage of oogenesis. CG17328 can affect the oogenesis process by regulating the 'dumping' process of nurse cells. The loss of CG17328 expression leads to significant decrease of the number of mature oocytes generated by ovaries and the hatching rate of eggs, which indicates that the loss or inhibition of CG17328 expression can achieve the control effect on drosophila melanogaster.

The invention discloses a method for creating low-fertility new phytolacca americana germplasm through irradiation mutagenesis and application. Belongs to the technical field of mutation breeding. According to the method disclosed by the invention, the < 60 > Co-gamma rays are used for carrying out irradiation treatment on the phytolacca americana seeds, so that a stable mutant group is successfully constructed. Through multi-generation screening, a low-breeding mutant strain with significantly improved biomass and limited reproductive capacity is obtained. Compared with wild phytolacca americana, the mutant strains show higher biomass and plant height in growth indexes, and show stronger growth vigor; the seed quantity and the pollen quantity are obviously lower than those of the wild type in breeding indexes, so that the ecological invasion risk is effectively reduced. According to the method, the heavy metal enrichment capacity of the phytolacca americana is reserved, a new thought and germplasm resources are provided for application of the phytolacca americana in heavy metal polluted land remediation, and the method has important ecological and environmental significance.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention relates to the field of biological prevention and control, in particular to a biological prevention and control method for spotted wing drosophila based on double-organism temperature control and a research method. The temperature for releasing the Pseudocera pupae is 18 DEG C. At 14 DEG C, no parasitic wasps emerge from the spotted wing drosophila melanogaster; the intrinsic growth rate and the periodontal growth rate of the pupa are obviously lower than those of the spotted wing drosophila at the same temperature; the optimal net parasitism rate, the weekly-limited parasitism rate and the stable parasitism rate of the Pachyrhizus pupae are observed at the temperature of 26 DEG C, but simulation data show that the number of the Pachyrhizus pupae populations can be remarkably reduced under the condition that damage is reduced by releasing a large number of Pachyrhizus pupae at the temperature of 18 DEG C; the high reproductive capacity of the Drosophila melanogaster at 22 DEG C and 26 DEG C obviously reduces the biological control efficiency of the Drosophila melanogaster, which indicates that more than thousands of times of parasitic wasps are needed and the control time is too late; and the long egg laying days and egg laying period at 18 DEG C are beneficial to the biological control efficiency.

The invention discloses an application of high-stress-resistance and high-pathogenicity Steinernemacarporapse XJ-39 nematode in prevention and treatment of Chinese chive maggots in arid and semi-arid regions, and provides a nematode strain S.carporapse XJ-39 which is high in pathogenicity to Chinese chive maggot pests, high in reproductive capacity and good in environmental adaptability at the same time. The corrected death rate of the Chinese chive maggots under the concentration of 150 IJs / larva reaches 75.55%; the number of live propagation nematodes of greater wax moths is 5.24 * 10 < 4 > IJs / larva and 2.10 * 10 < 4 > IJs / g; the death rate is 74.86% after treatment is conducted for 5 h at the temperature of 38 DEG C, and the death rate is only 23.64% after treatment is conducted for 4 h at the NaCl concentration of 10%; after being irradiated by 19W ultraviolet light for 4 hours, the death rate is 43.58%. The S.carpocapsae XJ-39 has good drought stress resistance, has relatively strong survivability under the humidity of a saturated solution of KCl and NaCl, and shows good compatibility with thiamethoxam. In the potting control effect, the control effect of mixed use of nematodes and thiamethoxam reaches 80% or above; after the pesticide is applied in the field, the correction control effect on Chinese chive maggots is 70.25%-60.24%, and the pesticide has fast-acting property and persistent effect. According to the technical scheme provided by the invention, healthy planting, sustainable and high-quality development of the Chinese chives in the arid and semi-arid regions can be further assisted.

The invention discloses a medicine for improving reproductive capacity, which is prepared by taking male tussah pupae as a raw material, the male tussah pupae of which the effective accumulated temperature is 160-200 DEG C after diapause is relieved are completely adopted to replace male silkworm moths, the medicine for improving reproductive capacity is prepared, and the preparation cost of the medicine is greatly reduced. Animal (mouse) experiment results show that compared with 100% male tussah moth powder, the prepared medicine can obviously promote the capture frequency and ejaculation frequency of mice, shorten the ejaculation incubation period and improve the reproductive capacity, and the effect is better.

The application discloses a device for breeding good species of crayfish and application thereof, and the device comprises a population selection unit and a family selection unit; the population selection unit is a cuboid in overall structure, and comprises a population selection water tank, a population selection crayfish tank and a crayfish nest; the population selection crayfish tank is detachably embedded in the population selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the population selection crayfish tank and the population selection water tank; the family selection unit is a cylinder in overall structure, and comprises a family selection water tank, a family selection crayfish tank and a crayfish nest; the family selection crayfish tank is detachably embedded in the family selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the family selection crayfish tank and the family selection water tank. Advantages of the device are as follows: the device utilizes the self behavior characteristics and external nest position advantages of crayfish to first breed parent individuals with strong bodies and strong resistance, and then remove the nest position advantages to breed individuals with strong reproductive capacity; and the device can obtain crayfish parents with stable genetic traits.

The present invention discloses a method for improving the heat tolerance of plant pollen by low-temperature pretreatment. During the flowering period of the plant, a short-term low-temperature pretreatment is carried out on the plant before high-temperature stress to improve the resistance of the plant pollen during the pollen development period under high-temperature stress. The results obtained by the present invention are helpful for taking preventive measures in production to improve the reproductive ability and yield of plants, especially autumn and winter crops, in high-temperature environments.

The present invention relates to a composition for improving the reproductive capacity of a livestock, which can improve productivity by improving the reproductive capacity of the livestock, prevent various problems that may be caused by abuse of a hormone preparation, and can reduce the economic burden (e.g., feed cost) of a feeder.

The invention relates to a compound microbial agent and application thereof, belongs to the technical field of microorganisms, and particularly discloses application of mixed fermented milk in a product for improving male functions. According to the application, the new application of the mixed fermented milk of the rhamnosus lactobacillus B6 and the streptococcus thermophilus XJ53 (CGMCC No.17323) in the aspect of improving male functions is disclosed for the first time, and the new application is specifically characterized by improving male fertility desire, reproductive capacity, seminiferous tubule dysfunction and spermatogenesis, testis oxidative stress activity, testis testosterone synthesis and sperm quality; the strain has a potential value of producing a gain substance for improving the male function by fermenting skimmed milk, and also prompts that the fermented milk has a potential application prospect for enhancing the male function.

The present application relates to a kind of sphingosine purposes, kit, the method for detecting the reproductive capacity of male mammal and device and the method for screening ram, and sphingosine is used as the reproductive capacity marker of male mammal;The method for detecting the reproductive capacity of male mammal includes: the content of sphingosine in the sample to be measured is detected, and based on the content of the sphingosine, the reproductive capacity of the animal corresponding to the sample to be measured is determined.Sphingosine is used as marker, the reproductive capacity of male mammal can be directly judged, and it is helpful to screen out the male mammal of high reproductive capacity as paternal line to reproduce, and the reproduction rate of animal can be improved.

The invention belongs to the technical field of biology, and particularly discloses a dsSAM50 / dsActin-coated MSNs nano-complex, a preparation method thereof and application of the dsSAM50 / dsActin-coated MSNs nano-complex in prevention and control of large thrips of cowpeas, dsSAM50 and dsActin are simultaneously loaded by adopting nano-carrier mesoporous silica nanoparticles (MSNs), double genes (dsSAM50 / dsActin) are loaded through the mesoporous silica nanoparticles (MSNs), and the dsSAM50 / dsActin-coated MSNs nano-complex is obtained through the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex and the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex. The technical bottlenecks that bare dsRNA is easy to degrade and low in delivery efficiency in the traditional RNAi technology are broken through. The complex significantly improves the cell delivery efficiency of lethal genes by virtue of the high load capacity and targeted release characteristic of the nano-material, not only can significantly inhibit the expression of SAM50 and Actin genes of the megalurothrips megalurothrips, but also can significantly reduce the fecundity of the megalurothrips megalurothrips, significantly improves the death rate of the megalurothrips megalurothrips, and has good application prospects. After the two dsRNAs and the MSNs form a complex, the control effect on the cowpea large thrips can be improved.