46 results about "Reproductive capacity" patented technology

The invention relates to the technical field of livestock and poultry breeding, in particular to a goat hybridization breeding method capable of achieving complete-cycle nutrition enhancement. The core of the method is that systematic nutrition intervention runs through the whole breeding process. Before hybridization, performing differential nutrition pretreatment on the parents for 60 days: feeding the female parents with a breeding nutrition enhancer added with components such as D-chiro-inositol and N-acetylcysteine, and supplementing sperm motility enhancer containing acetylated L-carnitine and ergothioneine to the male parents. In the gamete treatment stage, the oocytes are subjected to in-vitro maturation culture in a special culture solution containing components such as D-chiro-inositol and a growth differentiation factor 9; after the sperms are subjected to gradient centrifugal screening, completing in-vitro fertilization in an optimized fertilization culture solution; after the embryos develop into blastocysts in the sequential culture system, carrying out laparoscopic transplantation, and carrying out staged precise nutrition culture on the pregnant ewes. According to the method, through multi-level nutrition enhancement, the reproductive capacity of the goats and the growth performance of offspring are effectively improved.

The application discloses Bifidobacterium Pseudocatenulatum and application thereof, and the Bifidobacterium Pseudocatenulatum YSBP01CCTCC NO: M 20232067. Experiments prove that the Bifidobacterium Pseudocatenulatum can enhance the antioxidant capacity of Caenorhabditis elegans, prolong the life of the nematode, improve the activity and the reproductive capacity of the nematode, reduce fat accumulation, improve the mitochondrial membrane potential, and delay the aging of the body. The Bifidobacterium Pseudocatenulatum can also significantly inhibit the weight increase of a high-fat-diet mouse, reduce the TG level in serum of the mouse, significantly reduce the fasting blood glucose concentration, and effectively prevent and relieve obesity and type 2 diabetes.

The invention belongs to the technical field of microorganisms, and particularly relates to a sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V, a fungicide and application of the fungicide. The invention provides a sclerotinia sclerotiorum pathopoiesis and reproduction dual deletion strain (Sclerotinia sclerotiorum) SD3-9V, which is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 2026255. The sclerotinia sclerotiorum pathopoiesis and reproduction dual-deletion strain SD3-9V provided by the invention has no pathogenicity, and sclerotium formation ability is deleted, so that the sclerotinia sclerotiorum can be used as a plant vaccine for preventing sclerotinia rot, and has multiple advantages of high biological safety, reduction of sclerotinia rot morbidity and promotion of crop growth and flowering. The invention provides an effective way for providing a safer and more reliable microbial agent for preventing and treating sclerotiniose.

The invention discloses plasmin based on hermetia illucens and application thereof, and belongs to the technical field of biology. The plasmin based on the hermetia illucens is obtained by grinding and centrifuging larvae of the hermetia illucens in a PBS (Phosphate Buffer Solution) and extracting supernate. The invention further provides application of the plasmin based on the hermetia illucens in preparation of thrombolytic drugs. The plasmin is extracted from the hermetia illucens, and the hermetia illucens is short in breeding cycle, high in reproductive capacity, capable of being massively extracted in a short time and low in cost; the extracted plasmin has a remarkable thrombolysis effect and has a very good utilization value; the plasmin can be used for directly dissolving thrombus and degrading fibrinogen.

The application belongs to the technical field of pest control, and discloses application of a transcription factor CG17328 in control of drosophila melanogaster. The application discloses application of CG17328 in regulation of insect reproductive capacity. The application firstly screens a transcription factor for regulating the 'dumping' process of nurse cells in oogenesis of drosophila melanogaster by using transcriptome sequencing, genetics and molecular biology and other related technologies and means. The transcription factor is a ZAD-C2H2 type zinc finger protein CG17328. CG17328 is mainly located in the nuclei of nurse cells and oocytes in the late stage of oogenesis. CG17328 can affect the oogenesis process by regulating the 'dumping' process of nurse cells. The loss of CG17328 expression leads to significant decrease of the number of mature oocytes generated by ovaries and the hatching rate of eggs, which indicates that the loss or inhibition of CG17328 expression can achieve the control effect on drosophila melanogaster.

The invention belongs to the technical field of molecular marker assisted breeding, and particularly relates to an InDel molecular marker for identifying the production performance of large white pigs and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is GTTGCTGTGGCTGTGTTGTAGGTCGAAGACATGGCTGGC, and the InDel molecular marker is located at the 261th base to the 306th base of the nucleotide sequence shown in SEQ ID NO.1; a pig individual containing the InDel molecular marker sequence has relatively better growth traits and / or breeding traits compared with a pig individual without the InDel molecular marker sequence. The InDel molecular marker provided by the invention provides an effective way for efficiently and accurately predicting or identifying the growth rate and the reproductive capacity of the large white pigs on the molecular level, early breeding of multiple traits can be simultaneously carried out aiming at the molecular marker site, and the breeding period of excellent boars is greatly shortened.

The invention relates to the field of biological prevention and control, in particular to a biological prevention and control method for spotted wing drosophila based on double-organism temperature control and a research method. The temperature for releasing the Pseudocera pupae is 18 DEG C. At 14 DEG C, no parasitic wasps emerge from the spotted wing drosophila melanogaster; the intrinsic growth rate and the periodontal growth rate of the pupa are obviously lower than those of the spotted wing drosophila at the same temperature; the optimal net parasitism rate, the weekly-limited parasitism rate and the stable parasitism rate of the Pachyrhizus pupae are observed at the temperature of 26 DEG C, but simulation data show that the number of the Pachyrhizus pupae populations can be remarkably reduced under the condition that damage is reduced by releasing a large number of Pachyrhizus pupae at the temperature of 18 DEG C; the high reproductive capacity of the Drosophila melanogaster at 22 DEG C and 26 DEG C obviously reduces the biological control efficiency of the Drosophila melanogaster, which indicates that more than thousands of times of parasitic wasps are needed and the control time is too late; and the long egg laying days and egg laying period at 18 DEG C are beneficial to the biological control efficiency.

The application discloses a device for breeding good species of crayfish and application thereof, and the device comprises a population selection unit and a family selection unit; the population selection unit is a cuboid in overall structure, and comprises a population selection water tank, a population selection crayfish tank and a crayfish nest; the population selection crayfish tank is detachably embedded in the population selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the population selection crayfish tank and the population selection water tank; the family selection unit is a cylinder in overall structure, and comprises a family selection water tank, a family selection crayfish tank and a crayfish nest; the family selection crayfish tank is detachably embedded in the family selection water tank, and the crayfish nest is detachably embedded in the sandwiched layer between the family selection crayfish tank and the family selection water tank. Advantages of the device are as follows: the device utilizes the self behavior characteristics and external nest position advantages of crayfish to first breed parent individuals with strong bodies and strong resistance, and then remove the nest position advantages to breed individuals with strong reproductive capacity; and the device can obtain crayfish parents with stable genetic traits.

The application discloses a bacteria with limited reproduction capacity, a method for controlling bacterial reproduction and application, and belongs to the technical field of biotechnology and cell immunotherapy. The bacterial DNA comprises an unnatural amino acid orthogonal translation module, a suicide module and a rescue module. Based on the unnatural amino acid (ncAA) orthogonal translation system, the orthogonal genetic barrier theory is used, gene circuit design and element modularization are used, bacterial reproduction generations are accurately controlled, bacterial growth is effectively controlled, and the bacteria are prevented from escaping, and the bacteria have wide applicability. The bacteria and the method have wide application prospects in the development of attenuated live vaccines.

The application discloses a kind of built-in anti-ejaculation devices of stallion, it is related to the technical field of animal husbandry, including placing hose, support tube is placed in the inside of placing hose;The outer side wall of the open end of support tube is installed with snap ring, and the opposite surface of snap ring is installed with fixed assembly;One of snap ring is in abutment with the inner side wall of placing hose, and the other snap ring is in abutment with the opening of placing hose.The application discloses a kind of built-in anti-ejaculation devices of stallion, not only can realize the filtration of sperm of stallion, but also can make that tissue fluid can normally flow and avoid vas deferens congestion, and will not affect normal mating behavior of stallion, further, anti-ejaculation behavior is reversible, does not affect stallion recovery reproductive capacity in later period, overall built-in structure design is compact, fixed assembly is assembled firmly, can be long-term retained and used, no exposed component, safe and non-irritating, adapt to stallion physiological structure, and practicality is strong.

The invention relates to a goat fecundity-related SMAD4 gene SNP molecular marker, a primer pair, a kit and application thereof, and belongs to the technical field of goat breeding. The SNP molecular marker is located at the g.50731937 site of the SMAD4 gene, and the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1; a / C mutation exists at the 45bp position from the 5'end of the SNP molecular marker. By analyzing the goat SMAD4 gene, it is found for the first time that the gene region has a g.50731937 site, and the SNP molecular marker is significantly related to the goat reproductive capacity character. The SNP locus is obviously and positively correlated with the goat reproductive capacity character, particularly the first-birth lambing number of the goat, and can be used as a molecular marker for identifying the goat reproductive capacity character, so that early selection of the reproductive character is realized, and the breeding cycle is shortened by at least 2-3 years compared with a traditional method depending on lambing recording. In addition, after goats with high reproductive capacity characters are identified, the goats can be used for breeding the goats, and the effect and the purpose of improving breeding are achieved.

The invention discloses an application of curcumin in improving puberty male reproductive capacity damage caused by chemotherapeutic drugs. Aiming at the problems of testicular germ cell quantity reduction, oxidative stress injury, long-term fertility damage and the like caused by cytosine arabinoside chemotherapy, curcumin is applied while or before the cytosine arabinoside is applied. The application is realized through combined administration or a pharmaceutical composition containing curcumin and cytarabine. Experiments show that the scheme can effectively relieve testicular tissue form damage, reduce germ cell apoptosis and antagonize oxidative stress, and significantly improve the sperm quality of adult individuals. The invention provides a new potential strategy for synchronously protecting the reproductive function of a clinical child tumor patient during chemotherapy.

The invention provides a method for predicting the population development trend of field rice planthoppers by utilizing microorganisms of immigrated adults for the field of agricultural pests, which is characterized by comprising the following steps: collecting the immigrated adults of the rice planthoppers, and measuring the diversity and relative abundance of the microorganisms carried in the adults; establishing a relation model between the diversity and relative abundance of the microbiota and the life, fecundity and progeny short wing rate of immigrated adults; carrying out microbiota determination on rice planthopper adults of an immigration peak to be predicted to obtain diversity and relative abundance indexes, substituting the diversity and relative abundance indexes into the relation model, and predicting the life, the fecundity and the progeny short wing rate of the rice planthopper adults of the immigration peak; the development trend of the population is predicted when the rice planthoppers migrate according to the standard that the longer the imago life is, the higher the reproductive capacity or the short wing rate of the progeny is, the faster the subsequent number increase of the field rice planthopper population is, the higher the number is, and the heavier the harm is, and the development trend of the population is predicted when the rice planthoppers migrate into the rice planthoppers.

The present application relates to a method for increasing the reproductive capacity of Sirex noctilio by water bath treatment of Tenebrio molitor pupae, which comprises preparing a series of necessary materials and equipment, including Tenebrio molitor larvae, culture dishes, absorbent paper, glass pipettes, etc., and then feeding Tenebrio molitor under suitable conditions until pupation. Next, select Tenebrio molitor pupae that have not been hatched for more than 48 hours and have similar quality, and then perform constant temperature water bath treatment at 30 DEG C for 3 minutes to improve their physiological state. The treated Tenebrio molitor pupae are used as parasitic hosts of Sirex noctilio, and the method effectively increases the parasitization rate and success rate of Sirex noctilio on the alternative host Tenebrio molitor pupae, provides high-quality parasitic wasp resources for biological control, helps to reduce the use of chemical pesticides, protects the ecological environment, and realizes the sustainable development of agriculture and forestry.

The present invention relates to a composition for improving the reproductive ability of livestock, and can enhance productivity through improved reproductive ability of livestock and prevent various problems that may arise from indiscriminate use of hormonal preparations, and can alleviate economic burden of breeders, such as feed costs.

The present invention relates to a method for controlling a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crops, wherein (i) either a composition containing one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils (Curculionidae), in particular beet weevils (sugar beet weevil; Asproarthenis punctiventris), is applied to an agricultural area;or (ii) a composition comprising one or more types of nucleic acid molecules, in particular RNAi molecules, which inhibit the metabolism, development, reproductive capacity or viability of weevils, applied to trap plant strips at the edge of, within and / or around the agricultural area, wherein these trap plant strips are sown with a trap plant density of at least 50 plants / m2; such that the weevils, in particular the beet weevils, come into contact with the nucleic acid molecules, in particular the RNAi molecules, so that the development, reproductive capacity or viability of the weevils is inhibited.;

The present invention relates to a method for controlling a weevil infestation, in particular a beet weevil infestation, in the agricultural production of crop plants, wherein: (i) either a composition comprising one or more types of nucleic acid molecules, in particular interference RNA (RNAi) molecules, which inhibit the metabolism, development, reproductive ability or survivability of weevils (Curculionidae), in particular beet weevils (sugar beet weevils; Asproparthenis punctiventris), is applied to an area of agricultural land; or (ii) a composition which comprises one or more types of nucleic acid molecules, in particular of RNAi molecules, which inhibit the metabolism, the development, reproductive capacity or survivability of weevils, is applied to bait-plant strips at the edge of, in and / or around the area of agricultural land, wherein these bait-plant strips are sown with a bait-plant density of at least 50 plants / m2; such that the weevils, in particular the beet weevils, come into contact with the nucleic acid molecules, in particular the RNAi molecules, such that the development, reproductive capacity or survivability of the weevils is inhibited.

The invention belongs to the field of new application of medicines, and particularly relates to application of GSK2606414 in preparation of an insecticide and the insecticide prepared from the GSK2606414. The insecticide is prepared by mixing GSK2606414 serving as a core active component and an organic solvent dimethyl sulfoxide according to the mass-volume ratio of 1mg: 0.22 ml, and the reproductive capacity of pests is remarkably reduced by inhibiting ovarian development of prodenia litura and the egg laying amount of a single female prodenia litura. Experiments show that the GSK2606414 treatment can effectively shorten the length of the ovarian tube of the prodenia litura, reduce the actual egg laying amount and cause significant damage to the ovum form. The insecticide and the application thereof have the characteristics of high efficiency, high targeting property and good environmental compatibility, and a new strategy is provided for agricultural pest control.

The invention discloses an InDel marker located on a chromosome 9 of a pig and capable of regulating and controlling the papillary number heterosis of the pig and application of the InDel marker. The nucleotide sequence of the InDel marker is shown as SEQ ID NO: 1 or SEQ ID NO: 2; the site is located between the 79th site and the 80th site from the 5'end of the nucleotide sequence shown in SEQ ID NO: 1, and corresponds to insertion mutation of C between the 11197897 bp and the 11197898 bp on the No.9 chromosome of the international pig reference genome version 11.1. The InDel marker provided by the invention can be applied to crossbreeding of pigs so as to improve the nipple number heterosis of offspring pigs and realize genetic improvement of the pigs, and by breeding the pigs with the InDel marker genotype of T / T, the reproductive capacity of sows can be remarkably improved, and the number of weaned piglets can be increased.

The invention belongs to the technical field of bioengineering, and particularly relates to a salivary gland secretory protein gene, double-stranded RNA thereof and application of the salivary gland secretory protein gene in reduction of the survival rate of aphids. Wherein the salivary gland secretory protein genes are Mp5, Mp11, Mp44, Mp45, MpCOO2 and MpE and are used as dsRNA target genes to be applied to the reduction of the survival rate of aphids, and the nucleotide sequences of the genes Mp5, Mp11, Mp44, Mp45, MpCOO2 and MpE are respectively shown as SEQ ID NO. 1-6. The specific dsRNA is designed by targeting the myzus persicae salivary gland key secretory protein gene, the survival rate and the reproductive capacity of the myzus persicae are remarkably reduced, and the myzus persicae salivary gland key secretory protein gene has efficient lethality and good targeting property, is safe to non-target organisms, is environment-friendly, can replace chemical pesticides, has the advantages of simplicity and convenience in operation, low cost, easiness in field application and the like, and has a wide application prospect. A brand new biotechnology solution is provided for green and sustainable prevention and control of aphids.

The invention provides application of a pine wood nematode strain with high reproductive capacity and high pathogenicity in pesticide effect evaluation, and belongs to the technical field of plant disease and pest control. The number of the insect strain is CSCL-01, and the insect strain CSCL-01 is separated from pine nematode harmful wood in a national mountain forest farm in the Weihai hong city; the strain CSCL-01 has the advantages that a standard pine wood nematode strain which is stable in character, high in reproductive capacity and high in pathogenicity is provided, the reproductive capacity of the strain is high, a large number of uniform nematodes can be rapidly obtained, and the time cost and the operation difficulty of pesticide effect evaluation are reduced; the pathogenicity is strong and stable, the prevention and control effects of the medicament can be quickly and clearly reflected, and the efficiency and the credibility of pesticide effect evaluation are improved; when the method is applied to pesticide effect evaluation, the problems of incomparable pesticide effect data and poor repeatability caused by biological characteristic difference of wild insect strains in the prior art are solved, and a unified standard is provided for pesticide effect comparison of different laboratories and different medicaments.

The application discloses a traditional Chinese medicine composition for improving sow reproductive capacity and application thereof. The traditional Chinese medicine composition is prepared by accurate proportioning and comprises the following raw materials in parts by weight: Herba Epimedii: 1-10 parts; Semen Euryae: 1-10 parts; Spatholobus suberectus Dunn: 1-10 parts; Camellia oleifera Abel: 1-10 parts; Curcuma longa L: 1-7 parts; Radix Codonopsis: 1-6 parts. The traditional Chinese medicine composition can comprehensively regulate sow reproductive system and effectively solve problems such as estrus delay, high estrus return rate and litter reduction. In the application verification in multiple pig farms, the traditional Chinese medicine composition can significantly shorten the weaning-estrus interval of sows, promote the secretion of reproductive hormones, improve the conception rate, greatly increase the average total number of litters and improve the survival rate of piglets. The characteristics of no hormone and no chemical additive guarantee food safety, reduce breeding cost and promote the green and sustainable development of the animal husbandry. The application is suitable for various pig breeds and scale farms and has wide practical value and popularization potential.

The invention discloses an ostrinia furnacalis nuclear receptor HR39 gene, an RNA interference fragment, dsRNA and application thereof, and relates to the field of agricultural pest control. The full-length cDNA sequence of the HR39 gene is as shown in SED ID NO: 1, the amino acid sequence of the coded protein is as shown in SED ID NO: 2, and the sequence of the RNA interference fragment is as shown in SED ID NO: 3. The full-length cDNA sequence of the HR39 gene is obtained, a dsRNA segment targeting the gene is designed, transcription expression of the HR39 gene is successfully interfered, and results show that ovary development of female individuals interfering the HR39 is remarkably inhibited, the egg laying amount and the egg hatching rate are remarkably reduced, and the reproductive capacity of the female individuals is remarkably inhibited. The HR39 gene provided by the invention provides a molecular target for designing a specific and efficient nucleic acid pesticide to inhibit reproduction of pests, and has a good application prospect in green prevention and control of ostrinia furnacalis.

The application discloses application of a PLPP3 gene in regulating E2 generation of ovarian granulosa cells and belongs to the technical field of cell engineering and gene engineering. It is found for the first time that overexpression of PLPP3 significantly reduces the E2 level in supernatant of human ovarian granulosa cells, and inhibition of PLPP3 expression significantly increases the E2 level in supernatant of granulosa cells; overexpression of PLPP3 significantly reduces the E2 level in serum of mice, and inhibition of PLPP3 expression significantly increases the E2 level in serum of mice. The application has good application value for studying the influence mechanism of PLPP3 in ovarian follicle development, reproductive capacity and ovarian related diseases. Technical support is provided for improving the reproductive capacity of sows, and the application has important economic value for actual production of the pig industry.

The invention provides radix ophiopogonis oligosaccharide with an anti-aging effect as well as a preparation method and application of the radix ophiopogonis oligosaccharide. The radix ophiopogonis oligosaccharide is prepared by adopting a water extraction and alcohol precipitation method, and the preparation process has the characteristics of being green and safe. According to analysis of HPLC-ELSD (High Performance Liquid Chromatography-Evaporative Light Scattering Detector) and the like, the polymerization degree of the prepared dwarf lilyturf tuber oligosaccharide is mainly distributed between 2 and 25, and the dwarf lilyturf tuber oligosaccharide belongs to the field of natural oligosaccharide. Animal experiment results show that the oligosaccharide can significantly reduce accumulation of lipofuscin and lipid in an aging model, prolong life, improve exercise, swallowing and reproductive capacity, and up-regulate antioxidant enzyme level, and shows excellent anti-aging activity.

1. Name of the design product: water activity meter. 2. Use of the design product: effective moisture, product stability and microbial reproductive capacity for microorganisms to utilize or participate in chemical reactions in the balanced state of the reaction food. 3. Design points of the design product: in shape. 4. Picture or photo best indicating the design points: perspective view 1.

The invention relates to the technical field of animal nutrition and feed, and discloses a functional low-protein daily ration for down producing goats, which is composed of a basic daily ration with crude protein content of 9.0-10.0% and an additive formed by mixing rumen bypass L-glutamine particles and L-citrulline. Aiming at the problem of reproduction rate reduction caused by low-protein daily ration confirmed for the first time, the intestinal tract is repaired through the L-glutamine, and the L-glutamine and the L-glutamine can be metabolized and converted into arginine in vivo, so that the nitric oxide level and related reproductive hormone secretion are improved. The daily ration effectively solves the problems of low nitrogen utilization rate and reduced reproductive capacity of the down producing goats under the low-protein miscellaneous meal feeding condition, remarkably improves the conception rate and the nitrogen deposition level, and has the effects of reducing the cost and reducing emission.

This invention provides a transplanting device and restoration method for intertidal Japanese eelgrass plants, belonging to the field of ecological restoration technology. The transplanting device is an open frame with biodegradable rope perforations on two opposite sides, with biodegradable ropes connected to these perforations. A downwardly sloping mud-blocking plate is also provided around the perimeter of the device. This transplanting device reduces damage to the intertidal topography. After transplanting Japanese eelgrass, it effectively resists the impact of tides on the transplanted plants, promoting the growth of new roots and solving the problem of difficulty in fixing transplanted plants. Successfully transplanted Japanese eelgrass plants can quickly form communities through their own reproductive capacity, optimizing the surrounding habitat, improving environmental quality, and exerting significant ecological value.

The invention discloses a method for improving the reproductive performance of cattle by using betaine, and belongs to the technical field of animal reproduction biology. The method comprises applying an effective dose of betaine to bovine oocytes and / or granular cells thereof; the betaine is a natural quaternary ammonium type alkaloid with an anti-oxidation function. According to the invention, it is found through metabonomics that betaine is a key metabolite of cattle high-yield breeding traits for the first time, and it is proved that betaine has double beneficial effects in a cattle breeding system: on a granular cell level, the level of active oxygen in cells induced by hydrogen peroxide can be significantly reduced by adding 5 mM betaine, and oxidative stress can be effectively relieved; on the oocyte level, 0.5 mM betaine is added into an in-vitro maturation and / or embryo culture solution, so that the cleavage rate and blastocyst formation rate of the bovine in-vitro embryo can be remarkably increased. The invention provides a brand-new, safe and effective solution for improving the production efficiency and the reproductive capacity of the bovine in-vitro embryo.

The application provides a long-chain non-coding RNA MSTRG.5970.28 and application thereof, a product and a method for goose ovary development, relates to the technical field of biology, and provides a new long-chain non-coding RNA MSTRG.5970.28; the lncRNA MSTRG.5970.28 is related to the proliferation and apoptosis of goose follicular granulosa cells; by regulating the expression of the lncRNA MSTRG.5970.28, the related miRNA and gene of the proliferation and apoptosis of the follicular granulosa cells can be correspondingly regulated. By applying the lncRNA MSTRG.5970.28 and the corresponding product, the research on the proliferation and apoptosis of the follicular granulosa cells and the physiological and biochemical functions can be effectively guaranteed. In addition, by regulating the proliferation and apoptosis of the follicular granulosa cells through the lncRNA MSTRG.5970.28, the population reproductive capacity can be improved while the excellent characteristics of the goose germplasm resources are maintained, so that the industrialization development of geese is promoted, and the economic benefits are improved.