Method for screening and applying SNP (Single Nucleotide Polymorphism) sites of goat SMAD4 gene

Abstract

The invention relates to a goat fecundity-related SMAD4 gene SNP molecular marker, a primer pair, a kit and application thereof, and belongs to the technical field of goat breeding. The SNP molecular marker is located at the g.50731937 site of the SMAD4 gene, and the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1; a / C mutation exists at the 45bp position from the 5'end of the SNP molecular marker. By analyzing the goat SMAD4 gene, it is found for the first time that the gene region has a g.50731937 site, and the SNP molecular marker is significantly related to the goat reproductive capacity character. The SNP locus is obviously and positively correlated with the goat reproductive capacity character, particularly the first-birth lambing number of the goat, and can be used as a molecular marker for identifying the goat reproductive capacity character, so that early selection of the reproductive character is realized, and the breeding cycle is shortened by at least 2-3 years compared with a traditional method depending on lambing recording. In addition, after goats with high reproductive capacity characters are identified, the goats can be used for breeding the goats, and the effect and the purpose of improving breeding are achieved.

Description

Technical Field

[0001] This invention relates to the screening and application methods of SNP sites in the SMAD4 gene of goats, and belongs to the field of goat breeding technology. Background Technology

[0002] The reproductive performance of goats is one of the key factors affecting the economic benefits of sheep farming, with the number of lambs per litter being the core reproductive trait. Currently, increasing the number of lambs per litter in goats mainly relies on traditional breeding methods, but these methods have drawbacks such as long cycles, low efficiency, and low selection accuracy.

[0003] With the rapid development of modern biotechnology, research on improving the economic traits of livestock using modern molecular breeding techniques such as molecular marker-assisted selection is becoming increasingly widespread, playing a vital role in promoting the high-quality development of animal husbandry. By utilizing modern molecular biology methods to identify effective SNP loci in goat populations and selectively choosing goats with better economic traits such as litter size, early and accurate selection of breeding sheep can be achieved, significantly shortening the breeding cycle, improving breeding efficiency, and reducing the blind spots in the breeding process. This provides strong technical support for the breeding of goat prolific traits and has a profound impact on promoting the sustainable development of the goat industry.

[0004] Transforming growth factor-β (TGF-β) is a multifunctional cytokine that plays a significant role in extracellular matrix gene expression, matrix degradation, cell proliferation and differentiation, apoptosis, and immune function. TGF-β is also a pro-fibrotic factor; during fibrosis, it promotes extracellular matrix formation, stimulates fibroblasts to synthesize collagen, fibronectin, and proteoglycans, and promotes the expression of specific surface membrane receptors for extracellular matrix proteins. Furthermore, it can promote the transformation of epithelial cells into fibroblasts.

[0005] The SMAD4 gene is a key signaling molecule in the transforming growth factor-β (TGF-β) signaling pathway, which plays an important role in regulating reproductive processes such as ovarian development, follicle formation, and granulosa cell apoptosis in animals. However, to date, no published literature or patents have reported a significant association between specific single nucleotide polymorphism (SNP) sites in the SMAD4 gene and the lambing rate trait in goats, especially for the Dazu Black Goat, a superior local breed in China.

[0006] Therefore, providing a novel molecular marker strongly correlated with the number of lambs born in goats and its application scheme would provide a powerful tool for the efficient breeding of Dazu Black Goats and other goat breeds, effectively filling the gaps in existing technologies. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a method for screening and applying SNP sites in the goat SMAD4 gene.

[0008] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a SNP molecular marker for the SMAD4 gene associated with goat reproductive traits, wherein the SNP molecular marker is located at the g.50731937 site of the SMAD4 gene, and its nucleotide sequence is shown in SEQ ID NO.1; wherein the SNP molecular marker has an A / C mutation at the 45 bp from the 5' end.

[0009] According to a preferred embodiment of the present invention, the goat is the Dazu Black Goat.

[0010] According to a preferred embodiment of the present invention, the goat reproductive trait is the number of lambs born in the first litter, that is, when the 45bp site is base A and the genotype is AC, the number of lambs born in the first litter of the goat is higher than when the site is base C and the genotype is CC.

[0011] Secondly, the present invention provides a primer pair for specifically amplifying the above-mentioned SNP molecular marker, including an upstream primer and a downstream primer, the sequence information of which are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0012] Thirdly, the present invention provides a kit for detecting the above-mentioned SNP molecular markers, comprising primer pairs for specifically amplifying SNP molecular markers and detection reagents.

[0013] According to a preferred embodiment of the present invention, the detection reagent includes DNA extraction reagent, PCR reaction solution, 2×Taq PCRMaster mix and deionized water.

[0014] Fourthly, the present invention provides the application of the primer pairs for specifically amplifying SNP molecular markers or the kits for detecting SNP molecular markers in the identification of goat reproductive traits.

[0015] According to a preferred embodiment of the present invention, the application involves using primer pairs specifically for amplifying SNP molecular markers or a kit for detecting SNP molecular markers to perform PCR amplification on the genomic DNA of the goats to be screened, obtaining the amplification products, and sequencing them. Goats with the genotype AC for the SNP molecular markers are selected as goats with high reproductive capacity.

[0016] This invention provides the application of the primer pairs for specifically amplifying SNP molecular markers or the kits for detecting SNP molecular markers in the breeding of goats to improve reproductive traits.

[0017] According to a preferred embodiment of the present invention, the application is to use goats with high reproductive capacity after identification for goat breeding, so as to achieve the effect and purpose of improving breeding.

[0018] Fifthly, the present invention provides a method for detecting the SNP molecular marker at the g.50731937 site of the goat SMAD4 gene, comprising the following steps: Genomic DNA was extracted from the blood of the goat to be tested; Using the genomic DNA as a template, PCR amplification was performed using primer pairs that specifically amplify SNP molecular markers; After sequencing, the amplified products were compared with the goat SMAD4 gene sequence published in the NCBI database to determine the genotypes: AC and CC genotypes; When the genotype is AC, it is a goat with a high reproductive rate.

[0019] According to a preferred embodiment of the present invention, the goat is the Dazu Black Goat.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention, through analysis of the goat SMAD4 gene, has for the first time discovered a SNP molecular marker in this gene region that is significantly associated with goat fertility traits. This SNP molecular marker is located at position g.50731937 of the SMAD4 gene, with an A / C mutation at 45 bp from the 5' end of the sequence shown in SEQ ID NO. 1. No related reports have been found before, making this a newly discovered goat SNP molecular marker. Further analysis shows that this SNP site is significantly positively correlated with goat fertility traits, especially the number of lambs born in the first litter. It can serve as a molecular marker for identifying goat fertility traits, enabling early selection of reproductive traits and shortening the breeding cycle by at least 2-3 years compared to traditional methods relying on lambing records. Furthermore, goats with high fertility traits can be used for goat breeding after identification, achieving the effect and purpose of improved breeding.

[0021] 2. This invention designs specific PCR primers to amplify the SNP molecular marker of the goat SMAD4 gene, and performs gene sequencing on the amplified fragment to obtain the genotype of the locus, which can accurately, quickly, and save time and effort to detect the SNP molecular marker. Attached Figure Description

[0022] Figure 1 The electrophoretic detection results are for the genomic DNA of the Dazu Black Goat. In the image, all lanes except the marker contain genomic DNA from the Dazu Black Goat.

[0023] Figure 2 The results are from the electrophoresis detection of PCR products; In the figure, lanes 1 to 8 correspond to 8 groups of PCR products.

[0024] Figure 3 This is a comparison peak diagram of SMAD4 gene pool sequencing.

[0025] Figure 4 Electrophoresis images of PCR products of the SMAD4 gene at sites g.50731937 and g.50732111; In the figure, lanes 1-3 correspond to the PCR product of the g.50731937 site, and lanes 4-6 correspond to the PCR product of the g.50732111 site. Detailed Implementation

[0026] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. The described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Unless otherwise specified, the experimental techniques and scientific terms used in the following examples have the same meanings as commonly understood by a person skilled in the art. Unless otherwise noted, all experimental consumables and reagents are commercially available.

[0028] Example 1: Discovery of SNP sites 1. Laboratory animals 150 healthy, disease-free, and similarly raised adult female Chongqing Dazu Black Goats (purchased from Chongqing Tengda Animal Husbandry Co., Ltd.) with records of three or more lambings were selected. Subsequent experiments of this invention strictly adhered to the animal welfare and ethics review guidelines.

[0029] 2. Genomic DNA extraction At the slaughterhouse, 10 mL of jugular vein blood was collected from adult female Dazu Black Goats, placed in an anticoagulant tube containing EDTAK2, mixed by inversion, and labeled to obtain a blood sample, which was then stored at -20°C.

[0030] DNA was then extracted from the blood samples using the phenol-chloroform method, and its quality and concentration were determined by agarose gel electrophoresis and NanoDrop assay to obtain the genomic DNA of the Dazu Black Goat. The phenol-chloroform method is a conventional approach and can be performed using existing techniques.

[0031] Next, 5 μL of Dazu Black Goat genomic DNA was pipetted and mixed with 2 μL of loading buffer, then loaded onto the gel. Electrophoresis was performed at 100V for 30 min. The gel was then exposed to an imaging system. The results are as follows: Figure 1 As shown.

[0032] Depend on Figure 1The genomic DNA bands of the Dazu Black Goat were clear, neat, and without any dragging, exhibiting good brightness. This indicates that the Dazu Black Goat genomic DNA was successfully extracted and remained undegraded, making it suitable for subsequent experiments.

[0033] 3. Target region amplification and pooled sequencing ① Based on the sequence information of the SMAD4 gene (Gene ID: 100861019), primer sets (8 pairs) were designed using the Primer-BLAST tool, including upstream primers SMAD4-F1~8 and downstream primers SMAD4-R1~8, and were artificially synthesized by Wuhan Tianyi Biotechnology Co., Ltd. (Wuhan, China) according to the sequence information.

[0034] The specific sequence information of the primer sets (8 pairs) is as follows: SMAD4-F1: 5'-GTGGGACCCCCAACAGAAAT-3', SMAD4-R1: 5'-CGTAGCCGTAGCGGGTTATT-3'; SMAD4-F2: 5'-CGACAAGTTGGCAGCAACAA-3', SMAD4-R2: 5'-ACGGGGGAACTACCTCAGAA-3'; SMAD4-F3: 5'-GGAAGTGGGACCATTCTGGG-3', SMAD4-R3: 5'-ATTACAACCACCTCCGGCTG-3'; SMAD4-F4: 5'-ACTTTGGCAACAGGGTGTGA-3', SMAD4-R4: 5'-CGTCTAAAGTGAGCAGCCGA-3'; SMAD4-F5: 5'-ATTGGTTCCTGAGACGCGAG-3', SMAD4-R5: 5'-GGCACGTACAGAAGGGACAA-3'; SMAD4-F6: 5'-TGGCTGTGGGTGAGCTAATG-3', SMAD4-R6: 5'-GCTGAAGATGGCCGTTTTGG-3'; SMAD4-F7: 5'-TCGGCTGCTCACTTTAGACG-3', SMAD4-R7: 5'-ATACTGAGCCACTTGCCCAC-3'; SMAD4-F8: 5'-ACCTAGTAGAGGCCCCTGTG-3', SMAD4-R8: 5'-TCCTTCCCTACCCACTCGTT-3'.

[0035] ② The first-litter lambing count (LS) of the 150 adult ewes of Chongqing Dazu Black Goat was collected in detail. This data came from the data records of Chongqing Tengda Animal Husbandry Co., Ltd. over many years. Then, based on this data, a high-yield DNA pool (lambing count ≥ 2) and a low-yield DNA pool (lambing count = 1) were constructed. Each pool was composed of an equal amount of DNA samples.

[0036] Using the genomic DNA of Dazu Black Goats from the high-yield DNA pool (lambs born ≥ 2) and the low-yield DNA pool (lambs born = 1) as templates, PCR amplification was performed using primer sets (8 pairs) to obtain 8 sets of PCR products.

[0037] ③ PCR amplification system: 15 μL of 2×Taq PCR Master Mix, 1 μL of genomic DNA (~20 ng), 2 μL of upstream primer (5 pmol / μL), 2 μL of downstream primer (5 pmol / μL), 10 μL of ddH2O, and a total volume of 30 μL.

[0038] PCR amplification program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, for a total of 35 cycles; 72℃ final extension for 5 min, and storage at 16℃.

[0039] After mixing 5 μL of PCR product with 2 μL of loading buffer by pipetting, the sample was loaded and electrophoresed at 100V for 30 min. The gel was then exposed to an imaging system. The results are as follows. Figure 2 As shown.

[0040] Depend on Figure 2 It can be seen that the PCR product was successfully amplified and not degraded, and the bands were clear, neat, without any dragging, with good brightness, and the length was 500~750bp, which can be used for subsequent experiments.

[0041] 4. SNP site screening and genotyping determination The PCR products from the high-yield and low-yield DNA pools were sent to Wuhan Tianyi Biotechnology Co., Ltd. for target fragment sequencing. Chromas software was used for peak overlap detection, and the peak patterns were compared as shown below. Figure 3 As shown.

[0042] Depend on Figure 3 It can be seen that comparing the sequencing results of the high-yield DNA pool and the low-yield DNA pool reveals two mutation sites in the exon of the SMAD4 gene. g.50731937A>C and g.50732111T>C These are two SNP sites, denoted as g.50731937 and g.50732111, respectively.

[0043] Based on the two mutation sites g.50731937 and g.50732111, SMAD4-F / R-1 and SMAD4-F / R-2 were designed and tested, and Wuhan Tianyi Biotechnology Co., Ltd. (Wuhan, China) was commissioned to artificially synthesize them according to the sequence information.

[0044] The sequence information of the primers for detecting the g.50731937 site is as follows: SMAD4-F-1: 5'-GAGCTCGGAGGCGGCCCGGC-3' (SEQ ID NO. 2); SMAD4-R-1: 5'-TTCCTGCACACCGCCGTCAC-3' (SEQ ID NO. 3).

[0045] The sequence information of the primers for detecting the g.50732111 site is as follows: SMAD4-F-2: 5'-AACGCCTCGGGGCGGGGGGC-3'; SMAD4-R-2: 5'-CGGCCTGGTCAGTTAGGTGT-3'.

[0046] Using the genomic DNA of the Dazu Black Goat as a template, PCR amplification was performed using SMAD4-F / R-1 and SMAD4-F / R-2 primers, yielding two sets of PCR products. The PCR products were then subjected to electrophoresis and sequencing. The electrophoresis results are shown below. Figure 4 As shown.

[0047] The PCR amplification system is the same as above.

[0048] The PCR amplification was performed as touchdown PCR. The specific procedure was as follows: (1) Pre-denaturation: 95℃ for 3 min; (2) 10 cycles: denaturation at 95℃ for 30 s, annealing at 70℃ → 65℃ (decreasing by 0.5℃ per cycle) for 30 s, extension at 72℃ for 50 s; (3) 25 cycles: denaturation at 95℃ for 30 s, annealing at 65℃ for 30 s, extension at 72℃ for 50 s; (4) final extension at 72℃ for 5 min.

[0049] The sequencing results show that the nucleotide sequence of the SMAD4 gene at position g.50731937 is as follows: CCGCGCGGGCAGCGGCGCGGCGCCGAGGAGCGGGCGGCCTGGCC NGGAACGCCTCGGGGCGGGGGGCGAGGAGCGCGCCGACGCCCGCCGGGCGGAGGGACGAGCCGCGGCGGGAGAGCGGAAGCCCCTCGCCGTCGCCCGGGCCCAGGTAACGCGCCATGTCCCCCTCCCCTTCTCCCGGGCCGGGCCCGCGCGCCCCCGCCCGCGGCTTCCCCGCCCCGGGGCGGGCTCCGGGCGGCGGCGGGGAGCGCGCGCGGGAAGCCGGCGGGCCCGGCCCGGAGAACCGGCGCGGCCGCCTGACGGGCCGGGCCGGGCCGCGGCGCCTCGCGTCTCTCGGGCTCCGGAGTCGGTCCTGCGGCCCCGAGCTGCCCGCGGGGTCCGCGGCGGAACCGAGTGGAGCCCGCGCTGGGCGTGCTGCCGCGGCCGTCGCCACTCTTTGTTGTTCTGAGGTAGTTCCCCCGTCCCTCACGGCGGAGCGTGTCGGCCCCGGCGGGAGCGGGCTGCCTTCGGTGTGAATGAAAGTTGTGAATGGTCTCTCTTCATTTCTTTTCTCGAGCAGTTTTTTTTTTTTTCCTCTTTGTCCCTTATTTTCTCTTCCTGGTTGTGTCACTCCAGTTCGTGTTTCTGGCTTTGGTTTGTTGACTTTACTTTTTTGAGTACCGTGG (as shown in SEQ ID NO.1).

[0050] "N" in the sequence represents base A or C.

[0051] The nucleotide sequence of the SMAD4 gene at locus g.50732111 is as follows: GAGGAGCGCGCCGACGCCCGCCGGGCGGAGGGACGAGCCGCGGCGGGAGAGCGGAAGCCCCTCGCCGTCGCCCGGGCCCAGGTAACGCGCCATGTCCCCCTCCCCTTCTCCCGGGCCGGGCCCGCGCGCCCCCGCCCGCGGCTTCCCCGCC RCGGGGCGGGCTCCGGGCGGCGGCGGGGAGCGCGCGCGGGAAGCCGGCGGGCCCGGCCCGGAGAACCGGCGCGGCCGCCTGACGGGCCGGGCCGGGCCGCGGCTCTCGGGCTCCGGAGTCGGTCCTGCGGCCCCGAGCTGCCCGCGGGGTCCGCGGCGGAACCGAGTGGAGCCCGCGCTGGGCGTGCTGCCGCGGCCGTCGCCACTCTTTGTTG TTCTGAGGTAGTTCCCCCGTCCCTCACGGCGGAGCGTGTCGGCCCCGGCGGGAGCGGGCTGCCTTCGGTGTGAATGAAAGTTGTGAATGGTCTCTTCATTTCTTTTCGAGCAGTTTTTTTTTTTTTCCTCTTTGTCCCTTATTTTCTCTTCCTGGTTGTGTCACTCCAGTTCGTGTTTCTGGCTTTGGTTTGTTGACTTTACTTTTTTGAGTACCGTGG.

[0052] In the sequence, "R" represents the base T or C.

[0053] Depend on Figure 4 It was found that the PCR product was successfully amplified and not degraded, with clear and neat bands, no smearing, good brightness, and a length of 500-750 bp, which corresponds to the 665 bp and 598 bp of the sequencing results. Furthermore, the SMAD4 gene exhibits an A / C mutation at the 45 bp position (5' end) of the SNP marker at site g.50731937, and a T / C mutation at the 152 bp position (5' end) of the SNP marker at site g.50732111.

[0054] Finally, the genotype and allele frequencies of the SMAD4 gene at the g.50731937 and g.50732111 loci were analyzed using DnaSP software. The results are shown in Tables 1 and 2.

[0055] Table 1 Table 2 As can be seen from Tables 1 and 2, SMAD4 Genes in g.50731937A>C Two genotypes were identified at the locus: AC and CC. CC was the dominant genotype, with a frequency of 79.32%, while mutant gene A was the minor allele. g.50732111T>CTwo genotypes were found at the locus, namely CC type and TC type. The CC type is the dominant genotype with a genotype frequency of 74.55%. The mutant gene T is the minor allele.

[0056] Example 2: Genetic structure analysis of SNP loci in Dazu black goats Genetic structure analysis was performed on the g.50731937 locus and g.50732111 locus of the SMAD4 gene in Dazu black goats.

[0057] The genetic structure analysis included the number of effective alleles and polymorphic information content, testing for compliance with Hardy-Weinberg equilibrium, and population structure analysis. The results are shown in Tables 3 - 4.

[0058] The specific process of genetic structure analysis is as follows: The Microsatellite Toolkit software was used to calculate the effective allele (Effective allele number, Ne).

[0059] The POPGENE32 software was used to calculate the polymorphic information content (Polymorphic information, PIC); and when PIC < 0.25, it indicates that the data is in low polymorphism, when 0.25 < PIC < 0.5, it indicates that the data is in moderate polymorphism, and when PIC > 0.5, the data shows high polymorphism.

[0060] Table 3 Table 4 Note: P >0.05 indicates that the locus is in HWE .

[0061] Based on the data in Tables 3 - 4, the POPGENE32 software was used to test for compliance with Hardy-Weinberg equilibrium (Hardy-Weinberg equilibrium, HWE).

[0062] As can be seen from Tables 3 - 4, for the g.50731937A > C locus of the SMAD4 gene, Ne is 1.23, in low polymorphism, and in HWE; for the g.50732111T > C locus, Ne is 1.29, in low polymorphism, and not in HWE.

[0063] Example 3 SMAD4 Association analysis between the g.50731937 locus of the gene and reproductive traits 1. Collection of phenotypic data Detailed reproductive trait data were collected from 150 adult Chongqing Dazu Black Goat ewes described in Example 1, including the number of lambs born in the first litter (LS), the average number of lambs born in the first three litters (ALS3), the average birth weight in the first litter (ABW), and the average birth weight in the first three litters (ABW3). This reproductive trait data was obtained from years of data records from Chongqing Tengda Animal Husbandry Co., Ltd.

[0064] 2. Association analysis between the g.50731937 locus of the SMAD4 gene and reproductive traits. Association analysis was performed on the g.50731937 locus of the SMAD4 gene with the number of lambs in the first litter (LS), the average number of lambs in the first three litters (ALS3), the average birth weight in the first litter (ABW), and the average birth weight in the first three litters (ABW3) of adult ewes of Chongqing Dazu Black Goats using the GLM program in SAS 9.4 software. Results are expressed as least squares mean ± standard error (LSM ± SE). Multiple comparison analysis was then performed using the Duncan method. P A value <0.05 indicates a significant difference in the data. The mathematical model is: Population trait observation value = Population mean + Genotype effect value of the i-th individual + Individual random error. The results are shown in Tables 5 and 6.

[0065] Table 5 Table 6 (Note: In the same column, letters a and b indicate significant differences.) P <0.05).

[0066] As can be seen from Tables 5 and 6, SMAD4 Gene g.50731937A>C At this locus, the number of first-parity lambs born to the AC genotype was significantly higher than that of the CC genotype. P<0.05 This means that young ewes carrying the AC genotype exhibit higher reproductive efficiency during their first litter. In breeding practice, being able to select highly fertile individuals during a ewe's first litter can significantly shorten the generation interval, accelerate the genetic progress of the flock, and bring earlier economic returns to farmers.

[0067] Although SMAD4 Gene g.50731937A>CThe locus did not show statistically significant differences in average number of lambs in the first three litters (ALS3), average birth weight in the first litter (ABW), and average birth weight in the first three litters (ABW3), but this is a positive sign. This indicates that selecting the AC genotype to increase the number of lambs does not come at the expense of lamb birth weight and physical condition. Birth weight is a key factor affecting lamb survival rate, and maintaining a normal birth weight is crucial for reducing feeding and management difficulties and improving lamb survival rates. Furthermore, although not statistically significant, the average number of lambs in the first three litters for the AC genotype (1.67) is numerically higher than that for the CC genotype (1.47), suggesting that the AC genotype may have a stable high-yield potential throughout the ewe's reproductive peak.

[0068] and SMAD4 Gene g.50732111T>C The locus did not show significant differences in any of the measured reproductive traits (number of lambs in first litter, average number of lambs in the first three litters, and birth weight) (P>0.05), and could only exist as a detected polymorphic locus, but did not have the value of a molecular marker.

[0069] In summary, this invention, through analysis of the goat SMAD4 gene, has for the first time discovered a SNP molecular marker in this gene region that is significantly associated with goat fertility traits. This SNP molecular marker is located at position g.50731937 of the SMAD4 gene and is significantly positively correlated with goat fertility traits, particularly the number of lambs born in the first litter. It can serve as a molecular marker for identifying goat fertility traits, enabling early selection of reproductive traits. This provides a valuable direction for subsequent validation and breeding in larger populations. Furthermore, this trend may become more pronounced as the population size increases.

[0070] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A goat fertility trait-associated SMAD4 gene SNP molecular marker, characterized in that, The SNP molecular marker is located at the g.50731937 site of the SMAD4 gene, and the nucleotide sequence is shown as SEQ ID NO. 1; the SNP molecular marker has an A / C mutation at the 45th bp from the 5' end.

2. The SNP molecular marker of claim 1, wherein The goat is a Dazu black goat; the goat reproductive performance trait is the number of first lambing, that is, when the 45th bp is base A and the genotype is AC, the number of first lambing of the goat is higher than that when the site is base C and the genotype is CC.

3. A primer pair for specifically amplifying the SNP molecular marker of claim 1, characterized in that, The primer pair comprises an upstream primer and a downstream primer, and the sequence information is shown as SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

4. A kit for detecting the SNP molecular marker of claim 1, characterized in that, The kit comprises a primer pair for specifically amplifying the SNP molecular marker and a detection reagent.

5. The kit of claim 4, wherein The detection reagent comprises a DNA extraction reagent, a PCR reaction solution, 2x Taq PCR Master mix, and deionized water.

6. Application of the primer pair for specifically amplifying the SNP molecular marker or the kit for detecting the SNP molecular marker of claim 1 in identifying the reproductive performance trait of a goat.

7. Use according to claim 6, wherein The application is to use the primer pair for specifically amplifying the SNP molecular marker or the kit for detecting the SNP molecular marker to perform PCR amplification on the genomic DNA of a goat to be screened, sequence the amplification product, and screen the goat with the SNP molecular marker genotype of AC as a goat with a high reproductive performance trait.

8. Application of the primer pair for specifically amplifying the SNP molecular marker of claim 1 or the kit for detecting the SNP molecular marker of claim 1 in improving breeding of a goat reproductive performance trait.

9. A method for detecting the SNP molecular marker of the goat SMAD4 gene g.50731937 site, characterized in that, The application comprises the following steps: Extracting the genomic DNA of the blood of a goat to be detected; Using the primer pair for specifically amplifying the SNP molecular marker to perform PCR amplification on the genomic DNA as a template; After sequencing the amplification product, comparing it with the goat SMAD4 gene sequence published in the NCBI database to determine the genotyping: AC and CC genotypes; When the genotype is AC, it is a goat with a high reproductive performance trait.

10. The method of claim 9, wherein, The goat is a Dazu black goat.

Images