66 results about "Chinese Chive" patented technology

The utility model relates to the technical field of Chinese chive harvesters, and particularly discloses an integrated Chinese chive harvesting device which comprises a frame, two blades are arranged at the front end of the frame, a first box body is installed on the frame close to the two blades, a crank rocker mechanism is arranged in the first box body, and a second box body is installed at the top end of the frame. Moving wheels are arranged below the vehicle frame, a damping mechanism is installed between two of the moving wheels and the vehicle frame, an ash scattering mechanism is installed at the bottom end, close to the second box body, of the vehicle frame, a conveying mechanism is installed above the vehicle frame, and a bundling mechanism is installed in the second box body. According to the fragrant-flowered garlic harvester, fragrant-flowered garlic is conveyed to the temporary storage platform through the conveying belt after being harvested, the fragrant-flowered garlic falls into the bundling mechanism to be bundled after reaching the set weight and finally falls into the storage box, the fragrant-flowered garlic harvester completes bundling and storage work while harvesting is conducted, the fragrant-flowered garlic production operation time is effectively shortened, labor cost is reduced, and the fragrant-flowered garlic harvester is suitable for popularization and application. Integration of harvesting and bundling of the Chinese chives is achieved.

The invention provides an automatic harvester for Chinese chives, and relates to the technical field of harvesters, the automatic harvester comprises a machine head, two guide plates are symmetrically fixed to the front end of the machine head, a lifting machine box is installed at the tail end of the machine head, a delivery port is formed in the upper end of the lifting machine box, and a vertical frame is fixed to the rear end of the machine head; compared with the prior art, the multiple sets of collecting assemblies circularly rotate in the vertical frame through the chain wheel and chain devices, and when the different collecting assemblies correspond to the positions of the delivery ports, through rotation of shaft rods, the multiple sets of collecting assemblies can be separated from the delivery ports through rotation of the shaft rods. The collecting frame is pushed to the position of the outlet to conveniently receive the Chinese chives, meanwhile, the other side of the collecting frame sends the Chinese chives out of the collecting frame, in the process, the Chinese chives are screened in a shaking mode, and therefore the difficulty that impurities are manually and independently selected later is lowered, the Chinese chives are neatly arranged, and follow-up binding is facilitated.

The utility model relates to a novel Chinese chive harvesting device which comprises a machine frame, a gathering mechanism and a cutting mechanism, a plurality of wheels are arranged at the bottom of the machine frame, the gathering mechanism comprises two conical barrels arranged at intervals, the conical bottoms of the conical barrels face backwards and are rotationally connected to the front portion of the machine frame, and the cutting mechanism is arranged behind the gathering mechanism and connected with the machine frame. The first conveying mechanism is obliquely arranged on the rack, the first conveying mechanism comprises two sets of conveying assemblies arranged side by side, the ash scattering mechanism comprises a feeding port, an ash scattering pipe and a spiral conveyor, and the packaging mechanism is arranged behind the first conveying mechanism and connected to the rack; and the packaging mechanism is used for packaging the cut Chinese chives. According to the novel leek harvesting device, under the condition that leeks on the ground can be harvested and packaged, the functions of preserving moisture and fertilizer and scattering plant ash are achieved, the production efficiency is improved, the quality of the leeks is guaranteed, and farmers can conveniently store and sell the leeks.

The invention relates to the field of vegetable preservation, and discloses a preparation method of a volatile oil preservative and application of the volatile oil preservative in artemisia selengensis preservation, and the method comprises the following steps: step 1, weighing waste leaves and stems of artemisia selengensis, adding a sodium chloride solution, crushing with a juicer, then transferring into a round-bottom flask, enabling the round-bottom flask to be hermetically connected with a volatile oil steam distillation device to extract artemisia selengensis volatile oil, receiving volatile oil by using a centrifugal tube, and transferring the upper layer artemisia selengensis volatile oil by using a pipette; and step 2, weighing a hydrophilic emulsifier sucrose ester and chitosan powder, slowly adding the hydrophilic emulsifier sucrose ester and chitosan powder into the acetic acid solution, stirring while adding to avoid agglomeration, stirring at room temperature until the hydrophilic emulsifier sucrose ester and chitosan powder are completely dissolved to form a transparent or slightly milky white solution, adding the extracted artemisia selengensis volatile oil and glycerol, stirring in a sealed manner at room temperature, and degassing to obtain the artemisia selengensis volatile oil preservative. According to the method, a closed loop of waste recycling, preservative and homologous vegetable preservation can be realized, and the shelf life of artemisia selengensis is prolonged; meanwhile, the artemisia selengensis volatile oil has a certain compensation effect on the loss of the flavor of the clean artemisia selengensis.

The invention discloses a fragrant-flowered garlic fast harvesting-full-automatic fragrant-flowered garlic harvesting and binding machine, and relates to the technical field of agricultural harvesters. The device comprises a walking device, a mounting frame is mounted on the walking device, a cutting device, a grain lifting device, a clamping conveyor belt device, a binding and packaging device and a parallel conveyor belt device are mounted on the mounting frame, and the cutting device is matched with the grain lifting device. According to the device, automatic downward pressing action can be achieved, the binding and packaging efficiency and accuracy are improved, then the design that a half-shaped gear is meshed with a transmission gear is utilized, locking and fixing are conducted through a bolt, a downward pressing mechanism can accurately drive the gear to rotate, a preservative film is pulled out for supplement while downward pressing motion is conducted, the operation steps are simplified, and the working efficiency is improved. Through the design of interference fit and clearance fit, the relative movement between the gear shaft and the sleeve and the relative movement between the sleeve and the preservative film are more accurate, friction and clamping stagnation generated when the preservative film is pulled out are reduced, and the reliability and stability of equipment are improved.

The invention belongs to the technical field of agricultural biology, and particularly discloses application of honokiol in preparation of a bactericide for preventing and treating fungal diseases of plants, and honokiol is derived from plants, is a green, environment-friendly and high-safety small molecule compound, is wide in antibacterial spectrum and long in lasting period, and can be applied to prevention and treatment of fungal diseases of plants. The bactericidal composition can be used for effectively preventing and treating plant diseases of peanuts, corns, wheat, Chinese chives, soybeans, peppers, tomatoes and the like, can be applied to industrial crops such as various grains, melons and fruits, vegetables and the like, is safe to non-target organisms, meets the requirements of green sustainable development, and has a wide application value.

The application discloses a preparation device of a conditioning agent for reducing continuous cropping obstacles of Chinese chives and a preparation method thereof, wherein the device comprises a reaction kettle, the reaction kettle is provided with an input port for inputting raw materials on one side and an output port at the bottom, a transmission shaft capable of periodically variable-speed rotation is arranged concentrically in the reaction kettle, a first cross arm is arranged on the transmission shaft, a stirring rod parallel to the transmission shaft is arranged on the first cross arm, a plurality of groups of paddles are distributed on the stirring rod, an action mechanism is arranged on the first cross arm, the action mechanism is driven by the periodic variable-speed rotation of the transmission shaft and can drive the stirring rod to reciprocatingly rotate in the circumferential direction, and the mixing and stirring effect and efficiency of the raw materials can be improved by conveniently realizing the reciprocating rotation of the stirring rod while the stirring rod follows the circumferential rotation of the transmission shaft, so that time and labor are saved.

The utility model provides a leek harvesting and bundling all-in-one machine, which relates to the field of leek harvesters and comprises a frame, one end of the frame is fixedly provided with a righting optical shaft, the top of the righting optical shaft is provided with a righting plate, the surface of the frame is provided with a conveying assembly, the bottom of the frame is provided with a T-shaped plate through a connecting rod, and the T-shaped plate is provided with a connecting rod. A harvesting assembly is installed on the surface of the T-shaped plate, a driving assembly is fixedly installed on one side of the interior of the frame, a bundling machine is installed on the surface of the round rod, and a pressing assembly is installed on the surface of the bundling machine. According to the Chinese chive harvesting device, Chinese chives are centralized through the centralizing plate, the height of the centralizing plate is adjusted by starting the second adjusting assembly installed at the bottom of the centralizing plate, then the harvesting assembly is started to harvest the Chinese chives, the conveying assembly conveys the Chinese chives into the hook-shaped groove, and the first electric push rod is started to hook up a binding belt in the bundling machine; the driving assembly is started to enable the bundling machine to wrap the fragrant-flowered garlic, the second electric push rod is started for heavy pressing, and the pressing assembly is started to complete bundling.

The utility model discloses a leek harvesting and packing all-in-one machine, including frame, fostering subassembly, transmission subassembly, cutting subassembly, packing subassembly, falling box subassembly, fostering subassembly is installed on the frame, fostering subassembly includes a plurality of fostering plates, transmission subassembly includes a plurality of conveyor belts, one end of conveyor belt is close to fostering subassembly, and the other end of conveyor belt is close to packing subassembly. The cutting assembly is installed at the bottom of the rack and comprises a rotatable blade, the blade is located below the conveying belt, the packaging assembly comprises a lifting platform, the lifting platform is located between the conveying belt and the box falling assembly, and the box falling assembly can convey packaging boxes to the lifting platform one by one. The conveying assembly can convey Chinese chives cut by the blade into the packaging box of the lifting platform, the packaging assembly can convey the packaging box containing the Chinese chives out of the machine frame, the lifting platform is provided with a weighing plate, the harvested Chinese chives are loaded into the packaging box and weighed, the Chinese chives are directly packaged after being harvested, and labor time is saved.

The application discloses a SSR molecular marker primer related to Chinese chives dormancy and a detection method and application thereof. In view of the problems that traditional Chinese chives dormancy trait identification relies on field morphological observation for 4 months, is inefficient and lacks special molecular markers, 7 specific SSR primers (SSR005 / 170 / 249 / 325 / 423 / 478 / 610) are developed based on cross-species genome resequencing (taking Chinese onion as a reference genome, and the alignment rate is 18.76%-18.89%) for the first time. Through the establishment of a matching detection system: CTAB method for rapid DNA extraction, optimization of the PCR system (20 muL contains 30 ng of template DNA, 0.4 U of Taq enzyme, 0.2 muM of primer, 0.2 mM of Mg 2+ 2.0 mM of dNTPs, 57 DEG C annealing), 8% polyacrylamide gel electrophoresis combined with silver staining development, the dormancy trait can be accurately identified within 7 days. For example, the SSR423 primer has no band at 177 bp, and the non-dormant / dormant germplasm cannot be distinguished. The detection results of 52 germplasms (such as dormancy germplasm 21-1 and non-dormancy germplasm 22-7) are consistent with the field phenotypes at a rate of 100%.

The invention relates to the technical field of gene detection, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of root rot of Chinese chives, which comprises forward primers JBLB-F, FPLB-F and CCLB-F, reverse primers JBLB-R, FPLB-R and CCLB-R, and probes JBLB-P, FPLB-P and CCLB-P. The invention also provides a fluorescent quantitative PCR-based leek root rot pathogenic microorganism detection kit, which comprises the primer probe group. Meanwhile, the invention also provides a fluorescent quantitative PCR-based method for detecting pathogenic microorganisms of root rot of Chinese chives. Based on a probe method fluorescent quantitative PCR technology, in combination with high-sensitivity design of a specific primer probe group, accurate detection of low-copy pathogen nucleic acid can be realized, existence and quantity of pathogens can be determined in the early stage of the pathogens of the leek root rot, and early intervention and early warning of the root rot are facilitated.

The invention discloses application of fragrant-flowered garlic volatile matter in repelling bemisia tabaci. According to the invention, a gas chromatograph-mass spectrometer is used for identifying volatile matters in Chinese chives, and the main components of the volatile matters in Chinese chives are allyl methyl disulfide and diallyl disulfide. The two standard substances have different repelling effects on bemisia tabaci under different concentrations, and when the concentration of allyl methyl disulfide is 10 [mu] L / mL, the repelling effect on adult bemisia tabaci is better than that of allyl methyl disulfide with other concentrations; and when the concentration of diallyl disulfide is 100 [mu] L / mL, the repelling effect on bemisia tabaci adults is better than that of diallyl disulfide with other concentrations. When the allylmethyl disulfide and the diallyl disulfide are mixed in a ratio of 9: 1, the two standard substances have a remarkable repelling effect on bemisia tabaci adults, are small in dosage, simple and convenient to use and high in target property, and have important significance on green prevention and control of bemisia tabaci.

The invention discloses a traditional Chinese medicine composition for chronic obstructive pulmonary disease and a preparation method thereof, and belongs to the technical field of traditional Chinese medicines. The traditional Chinese medicine composition is prepared from the following raw material medicines in parts by mass: main medicines: 15-30 parts of radix rehmanniae preparata and 3-9 parts of semen allii tuberosi; auxiliary medicines: 10-30 parts of ginseng, 15-30 parts of astragalus membranaceus, 6-12 parts of ganoderma sinense, 6-12 parts of bighead atractylodes rhizome and 3-6 parts of schisandra chinensis; adjuvant drugs: 6-12 parts of radix ophiopogonis, 6-10 parts of rhizoma anemarrhenae, 6-10 parts of radix cyathulae and 6-10 parts of platycodon grandiflorum; and conductant drugs: 3-6 parts of radix bupleuri and 3-6 parts of rhizoma cimicifugae. The composition directly refers to the core pathogenesis of lung-kidney deficiency, the adjuvants reinforce lung and kidney tonifying, spleen strengthening and superficies consolidating, the adjuvants have the effects of nourishing yin, moistening dryness, reducing phlegm and activating blood, and the medicines prevent tonifying and stagnation, are orderly in lifting and descending and promote synergistic efficacy.

The invention discloses a traditional Chinese medicine fumigant for combustion type lung diseases and a preparation method thereof, and belongs to the field of important fumigants. The invention discloses a traditional Chinese medicine fumigant for combustion type lung diseases. Comprising the following raw materials in parts by weight: 5 parts of gastrodia elata, 5 parts of lucid ganoderma, 3 parts of bulbus fritillariae cirrhosae, 10 parts of desert cistanche, 5 parts of Chinese chive seeds, 10 parts of cynomorium songaricum, 10 parts of lycium ruthenicum, 5 parts of dendrobe, 10 parts of platycodon grandiflorum, 10 parts of pericarpium citri reticulatae, 10 parts of exocarpium citri grandis, 10 parts of poria cocos, 20 parts of dandelion, 10 parts of cucumber seeds, 5 parts of seaweed, 5 parts of angelica sinensis, 5 parts of cooked pseudo-ginseng, 10 parts of radix isatidis, 10 parts of folium mori, 5 parts of liquorice, 10 parts of cacumen platycladi and 10 parts of folia perillae acutae. And 150 parts of a fermentation broth.

The invention discloses leek harvesting and hotbed chive cultivation integrated equipment. The equipment comprises an advancing device, and a bionic cutting device, a sleeve conveying device, a flexible conveying device and a sleeve placing and stably holding device which are integrated on the advancing device. The bionic cutting device achieves bionic linkage of clamping, lifting and cutting through a single driving piece and a gear transmission mechanism, harvesting damage is effectively reduced, the sleeve conveying device is provided with a rotatable baffle mechanism, double-channel conveying blockage is prevented, the sleeve placing and stabilizing device adopts a double-groove cam separation mechanism and a clamping jaw type stabilizing mechanism, and the cutting efficiency is improved. And stable separation and placement of the sleeve are realized. The equipment can automatically identify the position and crop rotation of Chinese chives through integrating visual identification and a main control system, cooperatively controls each module to complete the whole-process integrated continuous operation from identification, harvesting, conveying to sun-shading sleeve placement, and has the advantages of high automation degree of operation, small crop damage, stable and reliable sleeve placement and suitability for large-scale continuous production.

100g of a main material is prepared in each 5000g of base wine, the base wine is 45-53-degree white wine, and the main material is prepared from the following components in parts by weight: 20-30 parts of medlar, 8-12 parts of poria cocos, 20-25 parts of saussurea involucrate, 7-10 parts of Chinese chive seeds, 3-5 parts of angelica sinensis, 5-8 parts of mulberries, 3-6 parts of liquorice, 25-35 parts of penis et testis cervi, 18-21 parts of cordyceps militaris, 20-30 parts of honey and 30-40 parts of brown sugar. The preparation method comprises the following steps: processing the first seven Chinese herbal medicines by an ancient method, drying to prepare powder, uniformly mixing and stirring with the dried and ground penis et testis cervi and cordyceps militaris, pretreating, uniformly mixing and soaking, and finally filtering and canning. The wine has a very obvious effect of conditioning and recovering the body of sub-health people caused by kidney deficiency, can play the real effects of the medlar and the poria cocos, and is rich in nutrition and good in taste. The invention further discloses a preparation method of the fructus lycii and poria cocos wine.

The embodiment of the utility model relates to the technical field of agricultural equipment, and discloses a self-propelled small-sized Chinese chive harvester. The harvester comprises a harvester body provided with a walking system; the dividing mechanism extends outwards from the front end of the harvester body; the two clamping rollers are located at the front end of the harvester body; the two conveying rollers of the electric cutter are located at the rear end of the harvester body; and the sponge body conveying belt is arranged on the clamping roller and the conveying roller in a sleeving manner, so that the clamping roller and the conveying roller rotate synchronously. The sponge body conveying belt sleeved with the two clamping rollers forms a clamping structure for clamping Chinese chives; the electric cutter is used for synchronously cutting the Chinese chives passing through the clamping structure; and the cut Chinese chives are clamped and conveyed by the sponge body conveying belt to move to the conveying rollers.

The utility model discloses an automatic gathering and separating device for a Chinese chive harvester, which comprises a mounting plate used for being fixedly connected with the Chinese chive harvester, and a fixed gathering mechanism, a raking mechanism and a discharging mechanism which are arranged on the mounting plate, and the discharging mechanism comprises a fixed receiving plate, a movable discharging plate and a discharging driving device, the movable discharging plate is movably connected with the fixed receiving plate, the discharging driving device comprises a center shaft, a discharging block and a discharging driving wheel, the discharging driving wheel is connected with a driving system of the Chinese chive harvester through a transmission mechanism, the center shaft is connected with the discharging driving wheel, and the discharging block is connected with the discharging driving wheel. The discharging block is arranged on the center shaft and abuts against the bottom of the movable discharging plate, so that leeks gathered by the leek harvester are discharged into the field in a split mode, leek harvesting mechanization and gathering and piling mechanization are achieved, the manual gathering time is shortened, and the labor intensity is lowered.

The invention relates to a gene detection technology, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of gray mold of Chinese chives, which comprises a primer HMB-F, a primer HMB-R and a probe P, wherein the sequence of the primer HMB-F is 5 'AAACTCGACCGCACAGATATT3', the sequence of the primer HMB-F is 5 'AAACTCGACCGCACATT3'; the sequence of the primer HMB-R is 5 'ACCTTGTTAGCTGGCATGAG 3', and the sequence of the probe P is 5 'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ 3'. The invention further provides a fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection and detection method, and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection kit and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection method have the advantages that existence and quantity of pathogens can be detected in the early stage of leek gray mold pathogens, and early intervention and early warning of gray mold are facilitated.

The invention discloses a method for distinguishing semen allii tuberosi and semen allii fistulosi based on a fingerprint spectrum technology, which comprises the following steps: extracting chemical components in a sample to be detected to prepare a test solution, and analyzing the test solution by using a fingerprint spectrum to obtain a chromatogram of the test solution; and judging whether the solution to be detected is semen allii tuberosi or semen allii fistulosi according to material components in the chromatogram. The method has the characteristics of simple principle, simplicity and convenience in operation and accurate result, and is convenient to popularize and apply.

The invention discloses an application of high-stress-resistance and high-pathogenicity Steinernemacarporapse XJ-39 nematode in prevention and treatment of Chinese chive maggots in arid and semi-arid regions, and provides a nematode strain S.carporapse XJ-39 which is high in pathogenicity to Chinese chive maggot pests, high in reproductive capacity and good in environmental adaptability at the same time. The corrected death rate of the Chinese chive maggots under the concentration of 150 IJs / larva reaches 75.55%; the number of live propagation nematodes of greater wax moths is 5.24 * 10 < 4 > IJs / larva and 2.10 * 10 < 4 > IJs / g; the death rate is 74.86% after treatment is conducted for 5 h at the temperature of 38 DEG C, and the death rate is only 23.64% after treatment is conducted for 4 h at the NaCl concentration of 10%; after being irradiated by 19W ultraviolet light for 4 hours, the death rate is 43.58%. The S.carpocapsae XJ-39 has good drought stress resistance, has relatively strong survivability under the humidity of a saturated solution of KCl and NaCl, and shows good compatibility with thiamethoxam. In the potting control effect, the control effect of mixed use of nematodes and thiamethoxam reaches 80% or above; after the pesticide is applied in the field, the correction control effect on Chinese chive maggots is 70.25%-60.24%, and the pesticide has fast-acting property and persistent effect. According to the technical scheme provided by the invention, healthy planting, sustainable and high-quality development of the Chinese chives in the arid and semi-arid regions can be further assisted.

The invention provides a nursing traditional Chinese medicine external preparation for relieving rheumatic arthralgia, and relates to the technical field of traditional Chinese medicines. On the basis of the theory of traditional Chinese medicine, a traditional Chinese medicine formula composed of pine nodular branch, ormosia henryi, shinyleaf pricklyash root, peach twig, lance asiabell root, arachnoid cyanotis root, dentiferous dendropanax root, rhizoma curculiginis, winter jasmine, wintergreen, folium cortex eucommiae, semen sesami nigrum, fructus viticis, semen allii tuberosi, rhizoma smilacis glabrae and herba menthae is prepared and used for externally treating rheumatoid arthritis in traditional Chinese medicine. The traditional Chinese medicine has the effects of promoting blood circulation to remove meridian obstruction, relieving swelling and pain, dispelling wind and eliminating dampness, tonifying liver and kidney, strengthening muscles and bones, clearing heat and promoting diuresis. The traditional Chinese medicine external preparation disclosed by the invention has excellent anti-inflammatory, detumescence and analgesic effects, has excellent performance in the aspects of improving clinical symptoms such as joint swelling, pain and pressing pain of a patient and improving sleep and joint functions, and takes effect quickly. The traditional Chinese medicine external preparation provides effective nursing means and measures for relieving or relieving rheumatic arthralgia.

The invention discloses a preparation method and application of a semen allii tuberosi active extract, and belongs to the technical field of deep processing of medicinal and edible plants. According to the method, only water and edible ethanol are used as solvents in the whole process, independent deproteinization and decolorization steps in which toxic organic solvents participate are not included, and the target extract is prepared through water extraction, concentration, alcohol precipitation, resin purification and drying under the synergistic effect of 65%-75% alcohol precipitation and 40% edible ethanol single-stage elution. The mass fraction of polysaccharide in the prepared extract reaches 25%-30%, the SORAC index of the superoxide free radical scavenging capacity is 5500.00-6000.00 [mu] mol SE / g, and the extract has high oxidation resistance and the activity of assisting in reducing blood sugar in the early stage of diabetes. The method is simple in process, easy to scale, safe and free of toxic solvent residues, the product can be directly used for food and health food, and a stable and feasible technical scheme is provided for high-valued application of the semen allii tuberosi.

The utility model provides a machine for harvesting leek roots. The machine comprises a power module, a soil turning module, a hooking module and a processing module which are arranged on a vehicle body capable of walking. Through the arrangement of the soil turning module, soil loosening operation is achieved, the hooking module can hook Chinese chive roots from soil conveniently, the Chinese chive roots are thrown to the processing module under the action of centrifugal force of the hooking module, and therefore automatic harvesting of the Chinese chive roots is achieved; furthermore, the processing module can be used for stacking the harvested Chinese chive roots on the ground, so that subsequent manual collection is facilitated.

The invention relates to the technical field of health-care food, and discloses a food composition for improving sperm concentration and a preparation method thereof, the food composition for improving sperm concentration comprises hippocampus, fresh oysters, mulberries, Chinese chive seeds, Chinese wolfberry fruits, algae and nereis. The natural food is used as the raw material, and the spirulina and the nereis are especially added, and the two components have relatively strong antioxidant ability, can effectively remove free radicals in the mouse body, reduce testis injury of the mouse, and further improve the sperm concentration of the mouse. Through intragastric administration of the food composition in the treatment period, it is found that the sperm concentration of a modeling mouse is increased by 2.9 times compared with that of a modeling mouse subjected to intragastric administration with normal saline, and the sperm concentration increasing effect is far higher than that of spermatogenic capsules widely sold in the market. Besides, the food composition is simple in preparation process, the adopted raw materials are all from natural food, and the food composition has the advantages of small toxic and side effects, wide and lasting effect and the like, and is widely distributed in nature, rich in resources and low in production cost.

The invention relates to the technical field of agricultural insecticides, in particular to a chlorfenapyr and chlorfluazuron compound insecticide and an application method thereof.The chlorfenapyr and chlorfluazuron compound insecticide comprises chlorfenapyr and chlorfluazuron with the mass ratio being 2: 1 and the total mass fraction being 10%-20%. The co-toxicity coefficient of the compound agent to Chinese chive maggots is larger than or equal to 153, LC50 is smaller than or equal to 2.12 mg / L, the 48-hour corrected death rate is larger than or equal to 93%, the control effect of the compound agent is remarkably better than that of a single component, the compound insecticide main agent is in a suspension dosage form and comprises a dispersing agent, a wetting agent, a thickening agent, a preservative and a pH regulator, the stability and uniformity of the agent are ensured, a root irrigation method is adopted as a field application method, the application amount per mu is 20-25 g, and the application amount per mu is 20-25 g. The fertilizer is diluted by 1500-2000 times and then added with 30-40 kg of water, the fertilizer is irrigated along the roots of Chinese chives, and the application time is that the height of Chinese chives seedlings is 10-15 cm or the hatching amount of Chinese chive maggot eggs is larger than 5 per plant.

The present invention provides a human spleen and stomach immunity enhancing ginseng and dendrobium aromatherapy powder, and relates to the field of traditional Chinese medicines, the human spleen and stomach immunity enhancing ginseng and dendrobium aromatherapy powder is prepared from the following raw materials: schisandra chinensis, Wedelia chinensis, herba epimedii, cistanche, raspberry, syngnathus, morinda officinalis, Chinese chive seeds, cinnamon, semen cuscutae, glossy privet fruit, red wolfberry, eucommia ulmoides, rhizoma curculiginis, polygonatum odoratum, polygonatum kingianum, prepared rehmannia root, astragalus membranaceus, codonopsis pilosula, licorice, ginseng, ganoderma lucidum, and dendrobium. Through reasonable compatibility of various traditional Chinese medicinal materials and synergistic effect of the various traditional Chinese medicinal materials, the functions of the spleen and the stomach are comprehensively conditioned and improved; the immunity of the organism can be enhanced, and the resistance of the organism to pathogenic microorganisms is improved by adjusting the activity of immune cells.

The invention discloses full-automatic fragrant-flowered garlic harvesting and packaging equipment based on multi-sensor cooperation, and relates to the field of agricultural harvesting machinery, the full-automatic fragrant-flowered garlic harvesting and packaging equipment comprises a walking vehicle frame, a fragrant-flowered garlic gathering and harvesting mechanism, a sensor module, a middle conveying belt, a weighing module, a contact type bundling module and a material frame feeding module, and the walking vehicle frame is a self-walking wheel type high-ground-clearance vehicle frame with a walking function; a placing position is arranged on the rear side of the walking frame, and a plurality of empty material frames which are stacked in a stacked mode are arranged in the placing position; the Chinese chive gathering and harvesting mechanism, the middle conveying belt and the contact type bundling module are sequentially arranged along the head, the middle and the tail of the walking frame. According to the full-automatic harvesting and packaging equipment for the Chinese chives, a continuous full-automatic harvesting and packaging scheme for the Chinese chives is constructed through multi-sensor cooperation and modular mechanical structure design, and full-process automatic control of gathering, conveying, cutting, metering, bundling and collecting of the Chinese chives is achieved; and the high-efficiency, low-loss and intelligent production requirements in a large-scale planting scene are met.

The utility model discloses a special fertilizer applicator for Chinese chives, and relates to the technical field of Chinese chive planting. The device comprises a base and a placement box fixedly connected to the top of the base, wherein a swing mechanism and a stirring mechanism are arranged on the base and the placement box; the swing mechanism comprises a first sliding groove formed in the base, a rack is arranged above the base, the bottom of the rack is fixedly connected with two first sliding rods, the bottoms of the two first sliding rods penetrate through the first sliding groove, the two first sliding rods are slidably connected with the first sliding groove, and the top of the base is fixedly connected with a second rack. Through the arrangement of the swing mechanism, the fertilizer applicator solves the problems that in the using process of an existing fertilizer applicator, uniform fertilization is difficult to conduct on Chinese chives with different line spacings, so that the fertilizer of the Chinese chives with part of line spacings is too much, seedlings are burnt and the like, and the fertilizer of the Chinese chives with part of line spacings is insufficient, growth is limited, and fertilizer efficiency is high. The amount of fertilizers obtained by plants is greatly different, and the overall growth uniformity of the Chinese chives is influenced.