75 results about "Allium tuberosum" patented technology

The invention provides an automatic harvester for Chinese chives, and relates to the technical field of harvesters, the automatic harvester comprises a machine head, two guide plates are symmetrically fixed to the front end of the machine head, a lifting machine box is installed at the tail end of the machine head, a delivery port is formed in the upper end of the lifting machine box, and a vertical frame is fixed to the rear end of the machine head; compared with the prior art, the multiple sets of collecting assemblies circularly rotate in the vertical frame through the chain wheel and chain devices, and when the different collecting assemblies correspond to the positions of the delivery ports, through rotation of shaft rods, the multiple sets of collecting assemblies can be separated from the delivery ports through rotation of the shaft rods. The collecting frame is pushed to the position of the outlet to conveniently receive the Chinese chives, meanwhile, the other side of the collecting frame sends the Chinese chives out of the collecting frame, in the process, the Chinese chives are screened in a shaking mode, and therefore the difficulty that impurities are manually and independently selected later is lowered, the Chinese chives are neatly arranged, and follow-up binding is facilitated.

The invention belongs to the technical field of agricultural biology, and particularly discloses application of honokiol in preparation of a bactericide for preventing and treating fungal diseases of plants, and honokiol is derived from plants, is a green, environment-friendly and high-safety small molecule compound, is wide in antibacterial spectrum and long in lasting period, and can be applied to prevention and treatment of fungal diseases of plants. The bactericidal composition can be used for effectively preventing and treating plant diseases of peanuts, corns, wheat, Chinese chives, soybeans, peppers, tomatoes and the like, can be applied to industrial crops such as various grains, melons and fruits, vegetables and the like, is safe to non-target organisms, meets the requirements of green sustainable development, and has a wide application value.

The invention discloses health-care deer medicinal liquor and a preparation method thereof. The health-care deer medicinal liquor is prepared from the following raw materials in parts by weight: 80 to 120 parts of Chinese chive seeds, 80 to 120 parts of fructus schisandrae chinensis, 80 to 120 parts of polygala tenuifolia, 80 to 120 parts of fructus alpiniae oxyphyllae, 80 to 120 parts of rhizoma anemones altaicae, 80 to 120 parts of radix cyathulae, 80 to 120 parts of fructus corni, 80 to 120 parts of semen cuscutae, 40 to 60 parts of radix morindae officinalis, 160 to 240 parts of radix ophiopogonis, 160 to 240 parts of radix polygonati officinalis, 480 to 720 parts of mulberries, 30 to 50 parts of lucid ganoderma and 20 to 40 parts of cornu cervi pantotrichum. The invention solves the problems that the existing medicinal liquor preparation process is relatively simple, normal-temperature soaking is generally adopted, deep effective components of medicinal materials are difficult to fully extract, the fusion degree of the effective components and liquor is relatively low, and the final curative effect of the medicinal liquor is reduced.

The utility model provides a leek harvesting and bundling all-in-one machine, which relates to the field of leek harvesters and comprises a frame, one end of the frame is fixedly provided with a righting optical shaft, the top of the righting optical shaft is provided with a righting plate, the surface of the frame is provided with a conveying assembly, the bottom of the frame is provided with a T-shaped plate through a connecting rod, and the T-shaped plate is provided with a connecting rod. A harvesting assembly is installed on the surface of the T-shaped plate, a driving assembly is fixedly installed on one side of the interior of the frame, a bundling machine is installed on the surface of the round rod, and a pressing assembly is installed on the surface of the bundling machine. According to the Chinese chive harvesting device, Chinese chives are centralized through the centralizing plate, the height of the centralizing plate is adjusted by starting the second adjusting assembly installed at the bottom of the centralizing plate, then the harvesting assembly is started to harvest the Chinese chives, the conveying assembly conveys the Chinese chives into the hook-shaped groove, and the first electric push rod is started to hook up a binding belt in the bundling machine; the driving assembly is started to enable the bundling machine to wrap the fragrant-flowered garlic, the second electric push rod is started for heavy pressing, and the pressing assembly is started to complete bundling.

A traditional Chinese medicine formula for treating blood vessel clogging belongs to the field of traditional Chinese medicine formulas, and comprises the following main raw materials: 29-31 parts of black pearl, 11-13 parts of codonopsis pilosula, 7-9 parts of saffron crocus, 8-10 parts of angelica sinensis, 190-210 parts of leek, 9-11 parts of pseudo-ginseng, 37-43 parts of hawthorn, 95-105 parts of astragalus membranaceus, 18-22 parts of kudzu vine root, 8-10 parts of peach kernel, 8-10 parts of prepared rehmannia root, 9-11 parts of radix rehmanniae, 11-13 parts of white paeony root, 3 parts of red ginseng, 9-11 parts of radix ophiopogonis, 14-16 parts of spina date seed, 11-13 parts of Chinese yam, 14-15 parts of schisandra chinensis, 9-11 parts of polygonum multiflorum, 7-9 parts of cinnamon, 18-21 , 13-15 parts of anise and 12-14 parts of rhizoma polygonati. The traditional Chinese medicine composition has an obvious improvement effect on coronary artery insufficiency, myocardial ischemia, mitral valve, tricuspid valve, aortic valve regurgitation, chronic heart failure, patients needing operation bypass stenting, angina pectoris, myocardial infarction sequelae, cerebral ischemia, cerebrovascular sequelae and other symptoms caused by cardiac insufficiency, the dosage is small, the effect is fast, the cure rate is high, relapse is not prone to occurring, and the traditional Chinese medicine composition is suitable for clinical application. The effects of tonifying qi and activating blood, dredging channels and relieving pain, eliminating phlegm and removing blood stasis, tonifying heart and soothing nerves and the like can be achieved.

The utility model discloses a leek harvesting and packing all-in-one machine, including frame, fostering subassembly, transmission subassembly, cutting subassembly, packing subassembly, falling box subassembly, fostering subassembly is installed on the frame, fostering subassembly includes a plurality of fostering plates, transmission subassembly includes a plurality of conveyor belts, one end of conveyor belt is close to fostering subassembly, and the other end of conveyor belt is close to packing subassembly. The cutting assembly is installed at the bottom of the rack and comprises a rotatable blade, the blade is located below the conveying belt, the packaging assembly comprises a lifting platform, the lifting platform is located between the conveying belt and the box falling assembly, and the box falling assembly can convey packaging boxes to the lifting platform one by one. The conveying assembly can convey Chinese chives cut by the blade into the packaging box of the lifting platform, the packaging assembly can convey the packaging box containing the Chinese chives out of the machine frame, the lifting platform is provided with a weighing plate, the harvested Chinese chives are loaded into the packaging box and weighed, the Chinese chives are directly packaged after being harvested, and labor time is saved.

The application discloses a SSR molecular marker primer related to Chinese chives dormancy and a detection method and application thereof. In view of the problems that traditional Chinese chives dormancy trait identification relies on field morphological observation for 4 months, is inefficient and lacks special molecular markers, 7 specific SSR primers (SSR005 / 170 / 249 / 325 / 423 / 478 / 610) are developed based on cross-species genome resequencing (taking Chinese onion as a reference genome, and the alignment rate is 18.76%-18.89%) for the first time. Through the establishment of a matching detection system: CTAB method for rapid DNA extraction, optimization of the PCR system (20 muL contains 30 ng of template DNA, 0.4 U of Taq enzyme, 0.2 muM of primer, 0.2 mM of Mg 2+ 2.0 mM of dNTPs, 57 DEG C annealing), 8% polyacrylamide gel electrophoresis combined with silver staining development, the dormancy trait can be accurately identified within 7 days. For example, the SSR423 primer has no band at 177 bp, and the non-dormant / dormant germplasm cannot be distinguished. The detection results of 52 germplasms (such as dormancy germplasm 21-1 and non-dormancy germplasm 22-7) are consistent with the field phenotypes at a rate of 100%.

The invention relates to the technical field of gene detection, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of root rot of Chinese chives, which comprises forward primers JBLB-F, FPLB-F and CCLB-F, reverse primers JBLB-R, FPLB-R and CCLB-R, and probes JBLB-P, FPLB-P and CCLB-P. The invention also provides a fluorescent quantitative PCR-based leek root rot pathogenic microorganism detection kit, which comprises the primer probe group. Meanwhile, the invention also provides a fluorescent quantitative PCR-based method for detecting pathogenic microorganisms of root rot of Chinese chives. Based on a probe method fluorescent quantitative PCR technology, in combination with high-sensitivity design of a specific primer probe group, accurate detection of low-copy pathogen nucleic acid can be realized, existence and quantity of pathogens can be determined in the early stage of the pathogens of the leek root rot, and early intervention and early warning of the root rot are facilitated.

The present application discloses a Streptomyces pseudovenezuelae and application of the Streptomyces pseudovenezuelae as a biocontrol agent in preventing and treating plant diseases. Streptomyces pseudogriseolus The Streptomyces pseudovenezuelae M5 screened by the present application is preserved in China Center for Type Culture Collection, and the preservation registration number is CCTCC NO: M 20252042. The Streptomyces pseudovenezuelae M5 screened by the present application has a strong inhibiting effect on a plurality of filamentous fungal pathogenic bacteria, has an obvious prevention and treatment effect on leek leaf rot disease caused by Alternaria alternata, and has an obvious effect on a newly discovered pathogenic bacterium Microdochium dimidiatum on blueberries. The M5 has a good biocontrol function and a growth promotion effect, has an excellent application prospect as a biocontrol agent for preventing and treating plant diseases, and especially provides an effective biocontrol preparation for diseases caused by the newly discovered pathogenic bacterium Microdochium dimidiatum on blueberries.

The present application belongs to the technical field of vegetable planting, and particularly relates to a three-color leek cultivation method. The three-color leek cultivation method provided by the present application comprises the following steps: after leek is grown in an open field to a plant height of 28-35 cm, the leek is grown in the dark for 3-6 days, the leek grows yellow leaves, the yellow leaves grow to 5-15 cm, and the three-color leek is obtained by harvesting the leek with a soil depth of 3-5 cm. The cultivation method adopts an open field + covering and shading mode, the leek is grown in the open field for 23-26 days, and the leek is covered and shaded for 3-6 days, so that the production time of one crop is 27-32 days. The three-color leek production is easy to operate and good to manage. When large-scale planting of the three-color leek is performed, a shading arched shed can be built after the leek grows to a certain height, so that the cultivation efficiency of the three-color leek can be significantly improved. The three-color leek has a low content of coarse fibers, a good quality, and a good taste. Compared with leek production, the three-color leek production can increase the annual income per mu by 52.57%.

The invention discloses leek harvesting and hotbed chive cultivation integrated equipment. The equipment comprises an advancing device, and a bionic cutting device, a sleeve conveying device, a flexible conveying device and a sleeve placing and stably holding device which are integrated on the advancing device. The bionic cutting device achieves bionic linkage of clamping, lifting and cutting through a single driving piece and a gear transmission mechanism, harvesting damage is effectively reduced, the sleeve conveying device is provided with a rotatable baffle mechanism, double-channel conveying blockage is prevented, the sleeve placing and stabilizing device adopts a double-groove cam separation mechanism and a clamping jaw type stabilizing mechanism, and the cutting efficiency is improved. And stable separation and placement of the sleeve are realized. The equipment can automatically identify the position and crop rotation of Chinese chives through integrating visual identification and a main control system, cooperatively controls each module to complete the whole-process integrated continuous operation from identification, harvesting, conveying to sun-shading sleeve placement, and has the advantages of high automation degree of operation, small crop damage, stable and reliable sleeve placement and suitability for large-scale continuous production.

The invention discloses traditional Chinese medicinal liquor for invigorating kidney and strengthening yang and application thereof. The traditional Chinese medicinal liquor is prepared from the following raw material medicines in parts by weight: 15-25 parts of male silkworm moth, 10-20 parts of fructus lycii, 10-20 parts of Chinese chive seeds, 10-20 parts of wine-processed rhizoma polygonati, 10-20 parts of herba cistanche, 10-20 parts of fructus rubi, 3-8 parts of ginseng and 3-8 parts (optional) of cortex cinnamomi. The preparation method comprises the following steps: 1) crushing the raw material medicines into coarse powder; (2) adding 50-60% grain liquor which is 4-8 times the amount of the coarse powder into the coarse powder, sealing and dipping at 20-25 DEG C for 10-30 days, and filtering; (3) adding 12-20% grain liquor with the amount 4-8 times that of the dregs, performing reflux extraction for 0.5-3 hours at the temperature of 60-80 DEG C, and filtering; 4) combining the two filtrates, intermittently stirring for 3-7 days, and filtering; 5) freezing the wine liquid at-10 to-20 DEG C for 1-3 days, and filtering; and 6) adding 0.1-0.5% of activated carbon, stirring for 1-3 hours, and filtering to obtain a finished product. The invention aims to improve the quality and stability of the medicinal liquor by combining a specific formula with step-by-step extraction, freezing sedimentation and activated carbon adsorption processes.

This utility model provides a chive cultivation device. The chive cultivation device includes: a cultivation box; a cultivation tray for planting chives, the cultivation tray being disposed on the cultivation box, the bottom of the cultivation tray having multiple ventilation holes; a draining plate, disposed inside the cultivation box, the draining plate having a filter cloth, the draining plate being located below the cultivation tray; a water holding tank, disposed inside the cultivation box, the water holding tank being located below the draining plate; and a storage box, the storage box being fixedly installed on the top of the cultivation box, the storage box having a partition fixedly installed inside, the partition dividing the storage box into a fertilizer storage chamber for storing organic liquid fertilizer and a water storage chamber. The chive cultivation device provided by this utility model can effectively separate excess water from the culture medium, realizing water recycling, and simultaneously cleaning and recycling the culture medium, avoiding waste of the culture medium.

The embodiment of the utility model relates to the technical field of agricultural equipment, and discloses a self-propelled small-sized Chinese chive harvester. The harvester comprises a harvester body provided with a walking system; the dividing mechanism extends outwards from the front end of the harvester body; the two clamping rollers are located at the front end of the harvester body; the two conveying rollers of the electric cutter are located at the rear end of the harvester body; and the sponge body conveying belt is arranged on the clamping roller and the conveying roller in a sleeving manner, so that the clamping roller and the conveying roller rotate synchronously. The sponge body conveying belt sleeved with the two clamping rollers forms a clamping structure for clamping Chinese chives; the electric cutter is used for synchronously cutting the Chinese chives passing through the clamping structure; and the cut Chinese chives are clamped and conveyed by the sponge body conveying belt to move to the conveying rollers.

This invention relates to the field of cleaning equipment technology, and in particular to an automated cleaning device for reducing mechanical damage to leafy vegetables. The top of the frame is equipped with a belt-pressing mechanism to prevent the chives from shifting during transport. A cleaning mechanism for washing and removing impurities from the chives is also installed at the top of the frame. A weighing mechanism is located at the outlet end of the belt conveyor on the frame, and a bundling mechanism is located on one side of the weighing mechanism. A receiving mechanism for removing the chives from the weighing mechanism is also provided on the frame. This invention utilizes a rotating double-toothed synchronous belt that engages with the belt conveyor to control the transport of chives. The double-toothed synchronous belt forms a flexible clamping area with the belt conveyor, making multi-point contact with the chive surface. This provides uniform pressure to constrain the root and stem posture, and the toothed engagement allows for synchronous movement with the belt conveyor. The double-toothed synchronous belt simultaneously conveys and constrains the chives, preventing them from shifting.

The invention relates to a gene detection technology, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of gray mold of Chinese chives, which comprises a primer HMB-F, a primer HMB-R and a probe P, wherein the sequence of the primer HMB-F is 5 'AAACTCGACCGCACAGATATT3', the sequence of the primer HMB-F is 5 'AAACTCGACCGCACATT3'; the sequence of the primer HMB-R is 5 'ACCTTGTTAGCTGGCATGAG 3', and the sequence of the probe P is 5 'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ 3'. The invention further provides a fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection and detection method, and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection kit and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection method have the advantages that existence and quantity of pathogens can be detected in the early stage of leek gray mold pathogens, and early intervention and early warning of gray mold are facilitated.

This invention relates to the field of agricultural environmental materials technology, and in particular to a salt-tolerant plant-based biochar soil conditioner and its preparation method. The conditioner uses salt-tolerant plant *Ilex chinensis* as the biochar raw material, which is prepared by compounding with porous mineral carrier diatomaceous earth and modifying with chitosan solution. The preparation method includes: washing, desalinating, drying, and pulverizing *Ilex chinensis*, followed by pyrolysis under limited oxygen conditions to obtain a biochar matrix; mixing the biochar and diatomaceous earth in a certain mass ratio, and achieving mechanical dispersion by wet ball milling; impregnating with chitosan acetic acid solution; and finally, separating the solid and liquid, drying, and solidifying to obtain a powdered product. This invention can effectively reduce soil pH and electrical conductivity, increase organic matter content, and significantly promote crop growth. It has the advantages of readily available raw materials, simple process, and long-lasting improvement effect, and is suitable for ecological restoration and agricultural utilization of coastal saline-alkali land.

The invention discloses an application of high-stress-resistance and high-pathogenicity Steinernemacarporapse XJ-39 nematode in prevention and treatment of Chinese chive maggots in arid and semi-arid regions, and provides a nematode strain S.carporapse XJ-39 which is high in pathogenicity to Chinese chive maggot pests, high in reproductive capacity and good in environmental adaptability at the same time. The corrected death rate of the Chinese chive maggots under the concentration of 150 IJs / larva reaches 75.55%; the number of live propagation nematodes of greater wax moths is 5.24 * 10 < 4 > IJs / larva and 2.10 * 10 < 4 > IJs / g; the death rate is 74.86% after treatment is conducted for 5 h at the temperature of 38 DEG C, and the death rate is only 23.64% after treatment is conducted for 4 h at the NaCl concentration of 10%; after being irradiated by 19W ultraviolet light for 4 hours, the death rate is 43.58%. The S.carpocapsae XJ-39 has good drought stress resistance, has relatively strong survivability under the humidity of a saturated solution of KCl and NaCl, and shows good compatibility with thiamethoxam. In the potting control effect, the control effect of mixed use of nematodes and thiamethoxam reaches 80% or above; after the pesticide is applied in the field, the correction control effect on Chinese chive maggots is 70.25%-60.24%, and the pesticide has fast-acting property and persistent effect. According to the technical scheme provided by the invention, healthy planting, sustainable and high-quality development of the Chinese chives in the arid and semi-arid regions can be further assisted.

The utility model provides a machine for harvesting leek roots. The machine comprises a power module, a soil turning module, a hooking module and a processing module which are arranged on a vehicle body capable of walking. Through the arrangement of the soil turning module, soil loosening operation is achieved, the hooking module can hook Chinese chive roots from soil conveniently, the Chinese chive roots are thrown to the processing module under the action of centrifugal force of the hooking module, and therefore automatic harvesting of the Chinese chive roots is achieved; furthermore, the processing module can be used for stacking the harvested Chinese chive roots on the ground, so that subsequent manual collection is facilitated.

The invention relates to the technical field of health-care food, and discloses a food composition for improving sperm concentration and a preparation method thereof, the food composition for improving sperm concentration comprises hippocampus, fresh oysters, mulberries, Chinese chive seeds, Chinese wolfberry fruits, algae and nereis. The natural food is used as the raw material, and the spirulina and the nereis are especially added, and the two components have relatively strong antioxidant ability, can effectively remove free radicals in the mouse body, reduce testis injury of the mouse, and further improve the sperm concentration of the mouse. Through intragastric administration of the food composition in the treatment period, it is found that the sperm concentration of a modeling mouse is increased by 2.9 times compared with that of a modeling mouse subjected to intragastric administration with normal saline, and the sperm concentration increasing effect is far higher than that of spermatogenic capsules widely sold in the market. Besides, the food composition is simple in preparation process, the adopted raw materials are all from natural food, and the food composition has the advantages of small toxic and side effects, wide and lasting effect and the like, and is widely distributed in nature, rich in resources and low in production cost.

The invention relates to the technical field of agricultural insecticides, in particular to a chlorfenapyr and chlorfluazuron compound insecticide and an application method thereof.The chlorfenapyr and chlorfluazuron compound insecticide comprises chlorfenapyr and chlorfluazuron with the mass ratio being 2: 1 and the total mass fraction being 10%-20%. The co-toxicity coefficient of the compound agent to Chinese chive maggots is larger than or equal to 153, LC50 is smaller than or equal to 2.12 mg / L, the 48-hour corrected death rate is larger than or equal to 93%, the control effect of the compound agent is remarkably better than that of a single component, the compound insecticide main agent is in a suspension dosage form and comprises a dispersing agent, a wetting agent, a thickening agent, a preservative and a pH regulator, the stability and uniformity of the agent are ensured, a root irrigation method is adopted as a field application method, the application amount per mu is 20-25 g, and the application amount per mu is 20-25 g. The fertilizer is diluted by 1500-2000 times and then added with 30-40 kg of water, the fertilizer is irrigated along the roots of Chinese chives, and the application time is that the height of Chinese chives seedlings is 10-15 cm or the hatching amount of Chinese chive maggot eggs is larger than 5 per plant.

The invention provides a making method of a crispy mutton pie, which relates to the field of food making, and is characterized in that the crispy mutton pie comprises 1000g of mutton (the fat-lean ratio is 3: 7), 150-200g of green Chinese onion, 100-150g of onion, 80-120g of leek, 8-12g of salt, 5-8g of cumin powder and 3-5g of fennel powder; the auxiliary materials of 5g of bruised ginger, 2g of white pepper and 10ml of sesame oil can be selected. The method has the advantages that by scientifically proportioning the mutton and the auxiliary materials (such as green Chinese onion, onion, leek and various spices), the mutton smell is effectively removed, and the overall flavor is improved; meanwhile, a multi-layer pastry structure is constructed by adopting the processes of multiple times of rolling, oil brushing, rolling and coiling, so that the finished product crust is distinct in gradation, crisp and delicious, and the problems that a traditional mutton pie is single in taste and not crisp in crust are remarkably solved. The method gives consideration to coordination of mutton smell removal, aroma enhancement and pastry forming, is high in operability and suitable for household or industrial production, and the prepared pie has nutrition, flavor and sensory quality and has a good market application prospect.

The present invention provides a human spleen and stomach immunity enhancing ginseng and dendrobium aromatherapy powder, and relates to the field of traditional Chinese medicines, the human spleen and stomach immunity enhancing ginseng and dendrobium aromatherapy powder is prepared from the following raw materials: schisandra chinensis, Wedelia chinensis, herba epimedii, cistanche, raspberry, syngnathus, morinda officinalis, Chinese chive seeds, cinnamon, semen cuscutae, glossy privet fruit, red wolfberry, eucommia ulmoides, rhizoma curculiginis, polygonatum odoratum, polygonatum kingianum, prepared rehmannia root, astragalus membranaceus, codonopsis pilosula, licorice, ginseng, ganoderma lucidum, and dendrobium. Through reasonable compatibility of various traditional Chinese medicinal materials and synergistic effect of the various traditional Chinese medicinal materials, the functions of the spleen and the stomach are comprehensively conditioned and improved; the immunity of the organism can be enhanced, and the resistance of the organism to pathogenic microorganisms is improved by adjusting the activity of immune cells.

The invention discloses full-automatic fragrant-flowered garlic harvesting and packaging equipment based on multi-sensor cooperation, and relates to the field of agricultural harvesting machinery, the full-automatic fragrant-flowered garlic harvesting and packaging equipment comprises a walking vehicle frame, a fragrant-flowered garlic gathering and harvesting mechanism, a sensor module, a middle conveying belt, a weighing module, a contact type bundling module and a material frame feeding module, and the walking vehicle frame is a self-walking wheel type high-ground-clearance vehicle frame with a walking function; a placing position is arranged on the rear side of the walking frame, and a plurality of empty material frames which are stacked in a stacked mode are arranged in the placing position; the Chinese chive gathering and harvesting mechanism, the middle conveying belt and the contact type bundling module are sequentially arranged along the head, the middle and the tail of the walking frame. According to the full-automatic harvesting and packaging equipment for the Chinese chives, a continuous full-automatic harvesting and packaging scheme for the Chinese chives is constructed through multi-sensor cooperation and modular mechanical structure design, and full-process automatic control of gathering, conveying, cutting, metering, bundling and collecting of the Chinese chives is achieved; and the high-efficiency, low-loss and intelligent production requirements in a large-scale planting scene are met.

The utility model discloses a special fertilizer applicator for Chinese chives, and relates to the technical field of Chinese chive planting. The device comprises a base and a placement box fixedly connected to the top of the base, wherein a swing mechanism and a stirring mechanism are arranged on the base and the placement box; the swing mechanism comprises a first sliding groove formed in the base, a rack is arranged above the base, the bottom of the rack is fixedly connected with two first sliding rods, the bottoms of the two first sliding rods penetrate through the first sliding groove, the two first sliding rods are slidably connected with the first sliding groove, and the top of the base is fixedly connected with a second rack. Through the arrangement of the swing mechanism, the fertilizer applicator solves the problems that in the using process of an existing fertilizer applicator, uniform fertilization is difficult to conduct on Chinese chives with different line spacings, so that the fertilizer of the Chinese chives with part of line spacings is too much, seedlings are burnt and the like, and the fertilizer of the Chinese chives with part of line spacings is insufficient, growth is limited, and fertilizer efficiency is high. The amount of fertilizers obtained by plants is greatly different, and the overall growth uniformity of the Chinese chives is influenced.

The invention relates to the technical field of farming equipment, and discloses a multifunctional Chinese chive seed harvesting machine and an operation method thereof.The multifunctional Chinese chive seed harvesting machine comprises a rack, and the rack is provided with a sowing and applying device located at the rear end of a harvester; the harvesting device is arranged at the front end of the rack, and the storage device is arranged at the rear end of the seed harvesting machine and used for storing fragrant-flowered garlic, weeds, seeds or fertilizer; the garlic chive harvester is characterized by further comprising a conveying device arranged on the rear side of the harvesting device and used for conveying garlic chives or weeds; the conveying device comprises a direction calibration conveyor in butt joint with the harvesting device and a transverse conveyor in butt joint with the sowing and applying device. Materials enter the conveying device through the harvesting device, the direction of the materials is changed from a vertical state to a horizontal state through the orientation calibration conveyor, smooth conveying of the materials in the complex operation link is guaranteed through cooperative work of the orientation calibration conveyor and the transverse conveyor, the number of times of equipment replacement is effectively reduced, and the working efficiency is improved. The integrated operation of harvesting, conveying, storing and sowing in the Chinese chive planting process is achieved.

The invention discloses an intelligent hydroponic leek disease plant protection method and device, and the method comprises the following steps: the maximum temperature of a greenhouse in the daytime is higher than 35 DEG C and lasts for more than 6 hours, high-pressure mist spraying of bacillus subtilis is performed once every week for conventional prevention, and high-pressure mist spraying of beewax water is performed once every week for physical plant protection; when the maximum temperature of the greenhouse in the daytime is not higher than 35 DEG C and the relative humidity is greater than 80%, performing preventive plant protection measures by adopting electrolyzed water covering mist; if the weather is maintained for a long time, the operation is continued, and chitin fog covering is carried out once every 10 days; according to occurrence characteristics of different diseases, especially gray mold and root rot of Chinese chives, graded and classified prevention and control strategies are formulated, a method combining biology, physics and chemistry is adopted, the prevention and control effect and environmental protection are considered, the usage amount of chemical agents is reduced, environmental pollution is reduced, and by combining environmental inducements of disease occurrence, the prevention and control effect is improved. Early warning and precise prevention and control of diseases are realized, and the occurrence probability of the diseases is reduced.

The invention discloses a leek ridging cultivation method which comprises the following steps: ridging and seedling planting are carried out by using an integrated seedling planting machine, a plurality of ridge surfaces which are connected into a whole and have a first width are formed when the integrated seedling planting machine is used for ridging, the widths of the furrows between the two adjacent ridge surfaces are alternately arranged between the second width and the third width; when the integrated seedling planting machine is used for planting seedlings, multiple rows of Chinese chives are planted on each ridge surface according to preset spacing, and the Chinese chives in each row are arranged according to preset spacing; laying a buried water pipe in the middle line of the furrow with the third width; a cultivator is used to move along the furrows and work on the ridge surfaces. Therefore, the system has the advantages of being high in integration level, high in working efficiency, good in adaptability, beneficial to large-scale planting and the like.

The utility model relates to the technical field of planting, and discloses a Chinese chive planting device capable of replacing running water, which comprises a main body assembly, a stand column, a lamp tube and an extension block, the lamp tube is arranged on one side of the stand column, and the extension block is fixed above the lamp tube; the adjusting assembly is located above the stand column, comprises a rotating piece and is arranged on the top of the stand column. The beneficial effects of the utility model are that through the arrangement of the adjusting assembly, the lamp source can periodically rotate around the stand column, and the lamp source rotates after being fixed at a certain position for a period of time, thereby changing the illumination angle, ensuring that the leeks at different positions on the stand column can obtain sufficient and uniform illumination at different time periods, improving the growth consistency of the leeks, and improving the quality of the leeks. Meanwhile, a planter can flexibly adjust the fixing time and the rotating period of the lamp source according to the growth stage, the illumination requirement, the actual environment condition and the like of the Chinese chives, the most suitable illumination condition is provided for the Chinese chives, and healthy growth of the Chinese chives is further promoted.

The application discloses a kind of LED as light supplement light source's allium tuberosum cultivation method, belong to plant cultivation technical field.The application described with LED as light supplement light source's allium tuberosum cultivation method includes the following steps: after allium tuberosum cutting, allium tuberosum is carried out light supplement treatment every day until 30d after allium tuberosum harvest stops;Then allium tuberosum is cut, and then repeat the above steps;The light supplement treatment includes: during the day, natural light, after night without natural light, with LED as light source, light supplement is carried out for 5h.The application provides a kind of efficient energy-saving, precision and can promote the light supplement scheme of allium tuberosum growth and quality improvement.By accurately controlling light source, light intensity, red and blue light ratio in light source and light supplement time, the yield and quality of allium tuberosum are effectively improved.