101 results about "Allium tuberosum" patented technology

The utility model relates to the technical field of Chinese chive harvesters, and particularly discloses an integrated Chinese chive harvesting device which comprises a frame, two blades are arranged at the front end of the frame, a first box body is installed on the frame close to the two blades, a crank rocker mechanism is arranged in the first box body, and a second box body is installed at the top end of the frame. Moving wheels are arranged below the vehicle frame, a damping mechanism is installed between two of the moving wheels and the vehicle frame, an ash scattering mechanism is installed at the bottom end, close to the second box body, of the vehicle frame, a conveying mechanism is installed above the vehicle frame, and a bundling mechanism is installed in the second box body. According to the fragrant-flowered garlic harvester, fragrant-flowered garlic is conveyed to the temporary storage platform through the conveying belt after being harvested, the fragrant-flowered garlic falls into the bundling mechanism to be bundled after reaching the set weight and finally falls into the storage box, the fragrant-flowered garlic harvester completes bundling and storage work while harvesting is conducted, the fragrant-flowered garlic production operation time is effectively shortened, labor cost is reduced, and the fragrant-flowered garlic harvester is suitable for popularization and application. Integration of harvesting and bundling of the Chinese chives is achieved.

The invention provides an automatic harvester for Chinese chives, and relates to the technical field of harvesters, the automatic harvester comprises a machine head, two guide plates are symmetrically fixed to the front end of the machine head, a lifting machine box is installed at the tail end of the machine head, a delivery port is formed in the upper end of the lifting machine box, and a vertical frame is fixed to the rear end of the machine head; compared with the prior art, the multiple sets of collecting assemblies circularly rotate in the vertical frame through the chain wheel and chain devices, and when the different collecting assemblies correspond to the positions of the delivery ports, through rotation of shaft rods, the multiple sets of collecting assemblies can be separated from the delivery ports through rotation of the shaft rods. The collecting frame is pushed to the position of the outlet to conveniently receive the Chinese chives, meanwhile, the other side of the collecting frame sends the Chinese chives out of the collecting frame, in the process, the Chinese chives are screened in a shaking mode, and therefore the difficulty that impurities are manually and independently selected later is lowered, the Chinese chives are neatly arranged, and follow-up binding is facilitated.

The utility model relates to a novel Chinese chive harvesting device which comprises a machine frame, a gathering mechanism and a cutting mechanism, a plurality of wheels are arranged at the bottom of the machine frame, the gathering mechanism comprises two conical barrels arranged at intervals, the conical bottoms of the conical barrels face backwards and are rotationally connected to the front portion of the machine frame, and the cutting mechanism is arranged behind the gathering mechanism and connected with the machine frame. The first conveying mechanism is obliquely arranged on the rack, the first conveying mechanism comprises two sets of conveying assemblies arranged side by side, the ash scattering mechanism comprises a feeding port, an ash scattering pipe and a spiral conveyor, and the packaging mechanism is arranged behind the first conveying mechanism and connected to the rack; and the packaging mechanism is used for packaging the cut Chinese chives. According to the novel leek harvesting device, under the condition that leeks on the ground can be harvested and packaged, the functions of preserving moisture and fertilizer and scattering plant ash are achieved, the production efficiency is improved, the quality of the leeks is guaranteed, and farmers can conveniently store and sell the leeks.

The invention discloses a fragrant-flowered garlic fast harvesting-full-automatic fragrant-flowered garlic harvesting and binding machine, and relates to the technical field of agricultural harvesters. The device comprises a walking device, a mounting frame is mounted on the walking device, a cutting device, a grain lifting device, a clamping conveyor belt device, a binding and packaging device and a parallel conveyor belt device are mounted on the mounting frame, and the cutting device is matched with the grain lifting device. According to the device, automatic downward pressing action can be achieved, the binding and packaging efficiency and accuracy are improved, then the design that a half-shaped gear is meshed with a transmission gear is utilized, locking and fixing are conducted through a bolt, a downward pressing mechanism can accurately drive the gear to rotate, a preservative film is pulled out for supplement while downward pressing motion is conducted, the operation steps are simplified, and the working efficiency is improved. Through the design of interference fit and clearance fit, the relative movement between the gear shaft and the sleeve and the relative movement between the sleeve and the preservative film are more accurate, friction and clamping stagnation generated when the preservative film is pulled out are reduced, and the reliability and stability of equipment are improved.

The invention belongs to the technical field of agricultural biology, and particularly discloses application of honokiol in preparation of a bactericide for preventing and treating fungal diseases of plants, and honokiol is derived from plants, is a green, environment-friendly and high-safety small molecule compound, is wide in antibacterial spectrum and long in lasting period, and can be applied to prevention and treatment of fungal diseases of plants. The bactericidal composition can be used for effectively preventing and treating plant diseases of peanuts, corns, wheat, Chinese chives, soybeans, peppers, tomatoes and the like, can be applied to industrial crops such as various grains, melons and fruits, vegetables and the like, is safe to non-target organisms, meets the requirements of green sustainable development, and has a wide application value.

The invention discloses health-care deer medicinal liquor and a preparation method thereof. The health-care deer medicinal liquor is prepared from the following raw materials in parts by weight: 80 to 120 parts of Chinese chive seeds, 80 to 120 parts of fructus schisandrae chinensis, 80 to 120 parts of polygala tenuifolia, 80 to 120 parts of fructus alpiniae oxyphyllae, 80 to 120 parts of rhizoma anemones altaicae, 80 to 120 parts of radix cyathulae, 80 to 120 parts of fructus corni, 80 to 120 parts of semen cuscutae, 40 to 60 parts of radix morindae officinalis, 160 to 240 parts of radix ophiopogonis, 160 to 240 parts of radix polygonati officinalis, 480 to 720 parts of mulberries, 30 to 50 parts of lucid ganoderma and 20 to 40 parts of cornu cervi pantotrichum. The invention solves the problems that the existing medicinal liquor preparation process is relatively simple, normal-temperature soaking is generally adopted, deep effective components of medicinal materials are difficult to fully extract, the fusion degree of the effective components and liquor is relatively low, and the final curative effect of the medicinal liquor is reduced.

The utility model provides a leek harvesting and bundling all-in-one machine, which relates to the field of leek harvesters and comprises a frame, one end of the frame is fixedly provided with a righting optical shaft, the top of the righting optical shaft is provided with a righting plate, the surface of the frame is provided with a conveying assembly, the bottom of the frame is provided with a T-shaped plate through a connecting rod, and the T-shaped plate is provided with a connecting rod. A harvesting assembly is installed on the surface of the T-shaped plate, a driving assembly is fixedly installed on one side of the interior of the frame, a bundling machine is installed on the surface of the round rod, and a pressing assembly is installed on the surface of the bundling machine. According to the Chinese chive harvesting device, Chinese chives are centralized through the centralizing plate, the height of the centralizing plate is adjusted by starting the second adjusting assembly installed at the bottom of the centralizing plate, then the harvesting assembly is started to harvest the Chinese chives, the conveying assembly conveys the Chinese chives into the hook-shaped groove, and the first electric push rod is started to hook up a binding belt in the bundling machine; the driving assembly is started to enable the bundling machine to wrap the fragrant-flowered garlic, the second electric push rod is started for heavy pressing, and the pressing assembly is started to complete bundling.

A traditional Chinese medicine formula for treating blood vessel clogging belongs to the field of traditional Chinese medicine formulas, and comprises the following main raw materials: 29-31 parts of black pearl, 11-13 parts of codonopsis pilosula, 7-9 parts of saffron crocus, 8-10 parts of angelica sinensis, 190-210 parts of leek, 9-11 parts of pseudo-ginseng, 37-43 parts of hawthorn, 95-105 parts of astragalus membranaceus, 18-22 parts of kudzu vine root, 8-10 parts of peach kernel, 8-10 parts of prepared rehmannia root, 9-11 parts of radix rehmanniae, 11-13 parts of white paeony root, 3 parts of red ginseng, 9-11 parts of radix ophiopogonis, 14-16 parts of spina date seed, 11-13 parts of Chinese yam, 14-15 parts of schisandra chinensis, 9-11 parts of polygonum multiflorum, 7-9 parts of cinnamon, 18-21 , 13-15 parts of anise and 12-14 parts of rhizoma polygonati. The traditional Chinese medicine composition has an obvious improvement effect on coronary artery insufficiency, myocardial ischemia, mitral valve, tricuspid valve, aortic valve regurgitation, chronic heart failure, patients needing operation bypass stenting, angina pectoris, myocardial infarction sequelae, cerebral ischemia, cerebrovascular sequelae and other symptoms caused by cardiac insufficiency, the dosage is small, the effect is fast, the cure rate is high, relapse is not prone to occurring, and the traditional Chinese medicine composition is suitable for clinical application. The effects of tonifying qi and activating blood, dredging channels and relieving pain, eliminating phlegm and removing blood stasis, tonifying heart and soothing nerves and the like can be achieved.

The invention relates to the technical field of Chinese chive harvesting and transferring, and discloses intelligent transferring equipment for Chinese chive harvesting and a transferring method.The intelligent transferring equipment comprises a bottom plate, a movement mechanism is arranged on the lower portion of the bottom plate, the movement mechanism is used for driving the bottom plate to move so as to facilitate transferring, and a mounting frame is connected to the bottom plate through a leveling mechanism; the garlic chive harvesting machine can move along with the garlic chive harvesting machine, material receiving can be achieved, harvested garlic chives are received into the material frame, and the harvesting and collecting efficiency is improved; according to the material frame clamping and feeding device, clamping and feeding of material frames can be achieved, clamping in multiple directions can be achieved during clamping, multiple clamping is achieved, clamping is firm, loosening is avoided, automatic clamping and feeding of the material frames are achieved, and the fully-collected material frames are placed in order; according to the leveling device, leveling in the moving process can be achieved, the inclination condition in the walking process is detected, then leveling is controlled, and leveling in multiple directions can be achieved.

The utility model discloses a leek harvesting and packing all-in-one machine, including frame, fostering subassembly, transmission subassembly, cutting subassembly, packing subassembly, falling box subassembly, fostering subassembly is installed on the frame, fostering subassembly includes a plurality of fostering plates, transmission subassembly includes a plurality of conveyor belts, one end of conveyor belt is close to fostering subassembly, and the other end of conveyor belt is close to packing subassembly. The cutting assembly is installed at the bottom of the rack and comprises a rotatable blade, the blade is located below the conveying belt, the packaging assembly comprises a lifting platform, the lifting platform is located between the conveying belt and the box falling assembly, and the box falling assembly can convey packaging boxes to the lifting platform one by one. The conveying assembly can convey Chinese chives cut by the blade into the packaging box of the lifting platform, the packaging assembly can convey the packaging box containing the Chinese chives out of the machine frame, the lifting platform is provided with a weighing plate, the harvested Chinese chives are loaded into the packaging box and weighed, the Chinese chives are directly packaged after being harvested, and labor time is saved.

The application discloses a SSR molecular marker primer related to Chinese chives dormancy and a detection method and application thereof. In view of the problems that traditional Chinese chives dormancy trait identification relies on field morphological observation for 4 months, is inefficient and lacks special molecular markers, 7 specific SSR primers (SSR005 / 170 / 249 / 325 / 423 / 478 / 610) are developed based on cross-species genome resequencing (taking Chinese onion as a reference genome, and the alignment rate is 18.76%-18.89%) for the first time. Through the establishment of a matching detection system: CTAB method for rapid DNA extraction, optimization of the PCR system (20 muL contains 30 ng of template DNA, 0.4 U of Taq enzyme, 0.2 muM of primer, 0.2 mM of Mg 2+ 2.0 mM of dNTPs, 57 DEG C annealing), 8% polyacrylamide gel electrophoresis combined with silver staining development, the dormancy trait can be accurately identified within 7 days. For example, the SSR423 primer has no band at 177 bp, and the non-dormant / dormant germplasm cannot be distinguished. The detection results of 52 germplasms (such as dormancy germplasm 21-1 and non-dormancy germplasm 22-7) are consistent with the field phenotypes at a rate of 100%.

The invention relates to the technical field of gene detection, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of root rot of Chinese chives, which comprises forward primers JBLB-F, FPLB-F and CCLB-F, reverse primers JBLB-R, FPLB-R and CCLB-R, and probes JBLB-P, FPLB-P and CCLB-P. The invention also provides a fluorescent quantitative PCR-based leek root rot pathogenic microorganism detection kit, which comprises the primer probe group. Meanwhile, the invention also provides a fluorescent quantitative PCR-based method for detecting pathogenic microorganisms of root rot of Chinese chives. Based on a probe method fluorescent quantitative PCR technology, in combination with high-sensitivity design of a specific primer probe group, accurate detection of low-copy pathogen nucleic acid can be realized, existence and quantity of pathogens can be determined in the early stage of the pathogens of the leek root rot, and early intervention and early warning of the root rot are facilitated.

The invention discloses application of fragrant-flowered garlic volatile matter in repelling bemisia tabaci. According to the invention, a gas chromatograph-mass spectrometer is used for identifying volatile matters in Chinese chives, and the main components of the volatile matters in Chinese chives are allyl methyl disulfide and diallyl disulfide. The two standard substances have different repelling effects on bemisia tabaci under different concentrations, and when the concentration of allyl methyl disulfide is 10 [mu] L / mL, the repelling effect on adult bemisia tabaci is better than that of allyl methyl disulfide with other concentrations; and when the concentration of diallyl disulfide is 100 [mu] L / mL, the repelling effect on bemisia tabaci adults is better than that of diallyl disulfide with other concentrations. When the allylmethyl disulfide and the diallyl disulfide are mixed in a ratio of 9: 1, the two standard substances have a remarkable repelling effect on bemisia tabaci adults, are small in dosage, simple and convenient to use and high in target property, and have important significance on green prevention and control of bemisia tabaci.

The invention discloses a traditional Chinese medicine fumigant for combustion type lung diseases and a preparation method thereof, and belongs to the field of important fumigants. The invention discloses a traditional Chinese medicine fumigant for combustion type lung diseases. Comprising the following raw materials in parts by weight: 5 parts of gastrodia elata, 5 parts of lucid ganoderma, 3 parts of bulbus fritillariae cirrhosae, 10 parts of desert cistanche, 5 parts of Chinese chive seeds, 10 parts of cynomorium songaricum, 10 parts of lycium ruthenicum, 5 parts of dendrobe, 10 parts of platycodon grandiflorum, 10 parts of pericarpium citri reticulatae, 10 parts of exocarpium citri grandis, 10 parts of poria cocos, 20 parts of dandelion, 10 parts of cucumber seeds, 5 parts of seaweed, 5 parts of angelica sinensis, 5 parts of cooked pseudo-ginseng, 10 parts of radix isatidis, 10 parts of folium mori, 5 parts of liquorice, 10 parts of cacumen platycladi and 10 parts of folia perillae acutae. And 150 parts of a fermentation broth.

The present application discloses a Streptomyces pseudovenezuelae and application of the Streptomyces pseudovenezuelae as a biocontrol agent in preventing and treating plant diseases. Streptomyces pseudogriseolus The Streptomyces pseudovenezuelae M5 screened by the present application is preserved in China Center for Type Culture Collection, and the preservation registration number is CCTCC NO: M 20252042. The Streptomyces pseudovenezuelae M5 screened by the present application has a strong inhibiting effect on a plurality of filamentous fungal pathogenic bacteria, has an obvious prevention and treatment effect on leek leaf rot disease caused by Alternaria alternata, and has an obvious effect on a newly discovered pathogenic bacterium Microdochium dimidiatum on blueberries. The M5 has a good biocontrol function and a growth promotion effect, has an excellent application prospect as a biocontrol agent for preventing and treating plant diseases, and especially provides an effective biocontrol preparation for diseases caused by the newly discovered pathogenic bacterium Microdochium dimidiatum on blueberries.

The present application belongs to the technical field of vegetable planting, and particularly relates to a three-color leek cultivation method. The three-color leek cultivation method provided by the present application comprises the following steps: after leek is grown in an open field to a plant height of 28-35 cm, the leek is grown in the dark for 3-6 days, the leek grows yellow leaves, the yellow leaves grow to 5-15 cm, and the three-color leek is obtained by harvesting the leek with a soil depth of 3-5 cm. The cultivation method adopts an open field + covering and shading mode, the leek is grown in the open field for 23-26 days, and the leek is covered and shaded for 3-6 days, so that the production time of one crop is 27-32 days. The three-color leek production is easy to operate and good to manage. When large-scale planting of the three-color leek is performed, a shading arched shed can be built after the leek grows to a certain height, so that the cultivation efficiency of the three-color leek can be significantly improved. The three-color leek has a low content of coarse fibers, a good quality, and a good taste. Compared with leek production, the three-color leek production can increase the annual income per mu by 52.57%.

The invention discloses leek harvesting and hotbed chive cultivation integrated equipment. The equipment comprises an advancing device, and a bionic cutting device, a sleeve conveying device, a flexible conveying device and a sleeve placing and stably holding device which are integrated on the advancing device. The bionic cutting device achieves bionic linkage of clamping, lifting and cutting through a single driving piece and a gear transmission mechanism, harvesting damage is effectively reduced, the sleeve conveying device is provided with a rotatable baffle mechanism, double-channel conveying blockage is prevented, the sleeve placing and stabilizing device adopts a double-groove cam separation mechanism and a clamping jaw type stabilizing mechanism, and the cutting efficiency is improved. And stable separation and placement of the sleeve are realized. The equipment can automatically identify the position and crop rotation of Chinese chives through integrating visual identification and a main control system, cooperatively controls each module to complete the whole-process integrated continuous operation from identification, harvesting, conveying to sun-shading sleeve placement, and has the advantages of high automation degree of operation, small crop damage, stable and reliable sleeve placement and suitability for large-scale continuous production.

100g of a main material is prepared in each 5000g of base wine, the base wine is 45-53-degree white wine, and the main material is prepared from the following components in parts by weight: 20-30 parts of medlar, 8-12 parts of poria cocos, 20-25 parts of saussurea involucrate, 7-10 parts of Chinese chive seeds, 3-5 parts of angelica sinensis, 5-8 parts of mulberries, 3-6 parts of liquorice, 25-35 parts of penis et testis cervi, 18-21 parts of cordyceps militaris, 20-30 parts of honey and 30-40 parts of brown sugar. The preparation method comprises the following steps: processing the first seven Chinese herbal medicines by an ancient method, drying to prepare powder, uniformly mixing and stirring with the dried and ground penis et testis cervi and cordyceps militaris, pretreating, uniformly mixing and soaking, and finally filtering and canning. The wine has a very obvious effect of conditioning and recovering the body of sub-health people caused by kidney deficiency, can play the real effects of the medlar and the poria cocos, and is rich in nutrition and good in taste. The invention further discloses a preparation method of the fructus lycii and poria cocos wine.

The invention discloses traditional Chinese medicinal liquor for invigorating kidney and strengthening yang and application thereof. The traditional Chinese medicinal liquor is prepared from the following raw material medicines in parts by weight: 15-25 parts of male silkworm moth, 10-20 parts of fructus lycii, 10-20 parts of Chinese chive seeds, 10-20 parts of wine-processed rhizoma polygonati, 10-20 parts of herba cistanche, 10-20 parts of fructus rubi, 3-8 parts of ginseng and 3-8 parts (optional) of cortex cinnamomi. The preparation method comprises the following steps: 1) crushing the raw material medicines into coarse powder; (2) adding 50-60% grain liquor which is 4-8 times the amount of the coarse powder into the coarse powder, sealing and dipping at 20-25 DEG C for 10-30 days, and filtering; (3) adding 12-20% grain liquor with the amount 4-8 times that of the dregs, performing reflux extraction for 0.5-3 hours at the temperature of 60-80 DEG C, and filtering; 4) combining the two filtrates, intermittently stirring for 3-7 days, and filtering; 5) freezing the wine liquid at-10 to-20 DEG C for 1-3 days, and filtering; and 6) adding 0.1-0.5% of activated carbon, stirring for 1-3 hours, and filtering to obtain a finished product. The invention aims to improve the quality and stability of the medicinal liquor by combining a specific formula with step-by-step extraction, freezing sedimentation and activated carbon adsorption processes.

The invention provides a feed for improving estrus rate of ewes and a preparation method thereof, and belongs to the technical field of feeds. The preparation method comprises the following steps: fermenting herba epimedii, radix morindae officinalis, herba leonuri and Chinese chive seeds with selenium-enriched saccharomycetes and manganese-enriched saccharomycetes, carrying out alcohol precipitation to obtain a solid and a liquid, adding a solid extraction agent into the liquid for extraction to obtain an extract, adding the extract and the compound polysaccharide into a basic ration, and uniformly stirring and mixing to obtain the feed for improving the estrus rate of the ewes. The feed for improving estrus rate of ewes is added with traditional Chinese medicine components, is safe, free of side effects, natural and not easy to generate drug resistance, and has a relatively good estrus promoting effect; the feed additive has multiple effects of enhancing the anti-stress ability of livestock and poultry, improving the immunity of the organism, improving the quality of livestock and poultry products, regulating the metabolism of the organism, promoting the growth and development of animals, inhibiting the growth of bacteria, enhancing the antioxidant ability and the like, and has a wide application prospect.

This utility model provides a chive cultivation device. The chive cultivation device includes: a cultivation box; a cultivation tray for planting chives, the cultivation tray being disposed on the cultivation box, the bottom of the cultivation tray having multiple ventilation holes; a draining plate, disposed inside the cultivation box, the draining plate having a filter cloth, the draining plate being located below the cultivation tray; a water holding tank, disposed inside the cultivation box, the water holding tank being located below the draining plate; and a storage box, the storage box being fixedly installed on the top of the cultivation box, the storage box having a partition fixedly installed inside, the partition dividing the storage box into a fertilizer storage chamber for storing organic liquid fertilizer and a water storage chamber. The chive cultivation device provided by this utility model can effectively separate excess water from the culture medium, realizing water recycling, and simultaneously cleaning and recycling the culture medium, avoiding waste of the culture medium.

The embodiment of the utility model relates to the technical field of agricultural equipment, and discloses a self-propelled small-sized Chinese chive harvester. The harvester comprises a harvester body provided with a walking system; the dividing mechanism extends outwards from the front end of the harvester body; the two clamping rollers are located at the front end of the harvester body; the two conveying rollers of the electric cutter are located at the rear end of the harvester body; and the sponge body conveying belt is arranged on the clamping roller and the conveying roller in a sleeving manner, so that the clamping roller and the conveying roller rotate synchronously. The sponge body conveying belt sleeved with the two clamping rollers forms a clamping structure for clamping Chinese chives; the electric cutter is used for synchronously cutting the Chinese chives passing through the clamping structure; and the cut Chinese chives are clamped and conveyed by the sponge body conveying belt to move to the conveying rollers.

The invention discloses a detachable soft-shelled turtle pond hydroponic leek planting and breeding device, which belongs to the field of hydroponic devices and comprises a plurality of floating plates capable of being freely detached and combined, and detachable protective plates are mounted on the outer sides of the floating plates. The floating plates can be detached and combined, the use mode is flexible, and the protection plates are detachably installed on the outer side edges of the floating plates to prevent soft-shelled turtles from climbing into the floating plates to gnaw fragrant-flowered garlic; the growth of the Chinese chives can absorb relatively high nitrogen, phosphorus and other nutrient substances in the soft-shelled turtle culture water body and take away eutrophicated substances in the soft-shelled turtle culture water body; the leek root system can release organic acid such as oxalic acid, thioether substances and active substances such as flavone, pathogenic microorganisms in a water body environment are inhibited, and the disease incidence rate of the soft-shelled turtles is reduced; the Chinese chive water planting device can be used for water planting of Chinese chives, can also be used for planting some Chinese herbal medicines, vegetables and the like suitable for water planting and can be repeatedly used.

This invention relates to the field of cleaning equipment technology, and in particular to an automated cleaning device for reducing mechanical damage to leafy vegetables. The top of the frame is equipped with a belt-pressing mechanism to prevent the chives from shifting during transport. A cleaning mechanism for washing and removing impurities from the chives is also installed at the top of the frame. A weighing mechanism is located at the outlet end of the belt conveyor on the frame, and a bundling mechanism is located on one side of the weighing mechanism. A receiving mechanism for removing the chives from the weighing mechanism is also provided on the frame. This invention utilizes a rotating double-toothed synchronous belt that engages with the belt conveyor to control the transport of chives. The double-toothed synchronous belt forms a flexible clamping area with the belt conveyor, making multi-point contact with the chive surface. This provides uniform pressure to constrain the root and stem posture, and the toothed engagement allows for synchronous movement with the belt conveyor. The double-toothed synchronous belt simultaneously conveys and constrains the chives, preventing them from shifting.

The invention relates to a gene detection technology, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of gray mold of Chinese chives, which comprises a primer HMB-F, a primer HMB-R and a probe P, wherein the sequence of the primer HMB-F is 5 'AAACTCGACCGCACAGATATT3', the sequence of the primer HMB-F is 5 'AAACTCGACCGCACATT3'; the sequence of the primer HMB-R is 5 'ACCTTGTTAGCTGGCATGAG 3', and the sequence of the probe P is 5 'FAM-CATGAAGACTCGGGTGCGGATAATGG-BHQ 3'. The invention further provides a fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection and detection method, and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection kit and the fluorescent quantitative PCR-based leek gray mold pathogenic microorganism detection method have the advantages that existence and quantity of pathogens can be detected in the early stage of leek gray mold pathogens, and early intervention and early warning of gray mold are facilitated.

This invention relates to the field of agricultural environmental materials technology, and in particular to a salt-tolerant plant-based biochar soil conditioner and its preparation method. The conditioner uses salt-tolerant plant *Ilex chinensis* as the biochar raw material, which is prepared by compounding with porous mineral carrier diatomaceous earth and modifying with chitosan solution. The preparation method includes: washing, desalinating, drying, and pulverizing *Ilex chinensis*, followed by pyrolysis under limited oxygen conditions to obtain a biochar matrix; mixing the biochar and diatomaceous earth in a certain mass ratio, and achieving mechanical dispersion by wet ball milling; impregnating with chitosan acetic acid solution; and finally, separating the solid and liquid, drying, and solidifying to obtain a powdered product. This invention can effectively reduce soil pH and electrical conductivity, increase organic matter content, and significantly promote crop growth. It has the advantages of readily available raw materials, simple process, and long-lasting improvement effect, and is suitable for ecological restoration and agricultural utilization of coastal saline-alkali land.

The invention discloses an application of high-stress-resistance and high-pathogenicity Steinernemacarporapse XJ-39 nematode in prevention and treatment of Chinese chive maggots in arid and semi-arid regions, and provides a nematode strain S.carporapse XJ-39 which is high in pathogenicity to Chinese chive maggot pests, high in reproductive capacity and good in environmental adaptability at the same time. The corrected death rate of the Chinese chive maggots under the concentration of 150 IJs / larva reaches 75.55%; the number of live propagation nematodes of greater wax moths is 5.24 * 10 < 4 > IJs / larva and 2.10 * 10 < 4 > IJs / g; the death rate is 74.86% after treatment is conducted for 5 h at the temperature of 38 DEG C, and the death rate is only 23.64% after treatment is conducted for 4 h at the NaCl concentration of 10%; after being irradiated by 19W ultraviolet light for 4 hours, the death rate is 43.58%. The S.carpocapsae XJ-39 has good drought stress resistance, has relatively strong survivability under the humidity of a saturated solution of KCl and NaCl, and shows good compatibility with thiamethoxam. In the potting control effect, the control effect of mixed use of nematodes and thiamethoxam reaches 80% or above; after the pesticide is applied in the field, the correction control effect on Chinese chive maggots is 70.25%-60.24%, and the pesticide has fast-acting property and persistent effect. According to the technical scheme provided by the invention, healthy planting, sustainable and high-quality development of the Chinese chives in the arid and semi-arid regions can be further assisted.

The utility model provides a machine for harvesting leek roots. The machine comprises a power module, a soil turning module, a hooking module and a processing module which are arranged on a vehicle body capable of walking. Through the arrangement of the soil turning module, soil loosening operation is achieved, the hooking module can hook Chinese chive roots from soil conveniently, the Chinese chive roots are thrown to the processing module under the action of centrifugal force of the hooking module, and therefore automatic harvesting of the Chinese chive roots is achieved; furthermore, the processing module can be used for stacking the harvested Chinese chive roots on the ground, so that subsequent manual collection is facilitated.

The invention relates to the technical field of health-care food, and discloses a food composition for improving sperm concentration and a preparation method thereof, the food composition for improving sperm concentration comprises hippocampus, fresh oysters, mulberries, Chinese chive seeds, Chinese wolfberry fruits, algae and nereis. The natural food is used as the raw material, and the spirulina and the nereis are especially added, and the two components have relatively strong antioxidant ability, can effectively remove free radicals in the mouse body, reduce testis injury of the mouse, and further improve the sperm concentration of the mouse. Through intragastric administration of the food composition in the treatment period, it is found that the sperm concentration of a modeling mouse is increased by 2.9 times compared with that of a modeling mouse subjected to intragastric administration with normal saline, and the sperm concentration increasing effect is far higher than that of spermatogenic capsules widely sold in the market. Besides, the food composition is simple in preparation process, the adopted raw materials are all from natural food, and the food composition has the advantages of small toxic and side effects, wide and lasting effect and the like, and is widely distributed in nature, rich in resources and low in production cost.

The invention relates to the technical field of agricultural insecticides, in particular to a chlorfenapyr and chlorfluazuron compound insecticide and an application method thereof.The chlorfenapyr and chlorfluazuron compound insecticide comprises chlorfenapyr and chlorfluazuron with the mass ratio being 2: 1 and the total mass fraction being 10%-20%. The co-toxicity coefficient of the compound agent to Chinese chive maggots is larger than or equal to 153, LC50 is smaller than or equal to 2.12 mg / L, the 48-hour corrected death rate is larger than or equal to 93%, the control effect of the compound agent is remarkably better than that of a single component, the compound insecticide main agent is in a suspension dosage form and comprises a dispersing agent, a wetting agent, a thickening agent, a preservative and a pH regulator, the stability and uniformity of the agent are ensured, a root irrigation method is adopted as a field application method, the application amount per mu is 20-25 g, and the application amount per mu is 20-25 g. The fertilizer is diluted by 1500-2000 times and then added with 30-40 kg of water, the fertilizer is irrigated along the roots of Chinese chives, and the application time is that the height of Chinese chives seedlings is 10-15 cm or the hatching amount of Chinese chive maggot eggs is larger than 5 per plant.