Fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group, kit and detection method for pathogenic microorganisms of root rot of Chinese chives

By using real-time PCR technology and a specific primer and probe set to detect the pathogen of leek root rot, the problem of early detection was solved, enabling early intervention and precise control, and reducing economic losses and pesticide residue risks.

CN121472449APending Publication Date: 2026-02-06WUHU 3H BIOTECHNOLOGY CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202511684246.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2026-02-06

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect pathogenic microorganisms in the early stages of leek root rot, leading to delayed control measures and economic losses.

Method used

Using a primer and probe set and kit based on real-time quantitative PCR, simultaneous detection of Fusarium oxysporum, Fusarium solani, and Fusarium latifolium was achieved through specific primers and fluorescently labeled probes. Combined with Ct value analysis, the presence and quantity of pathogens were determined at an early stage.

Benefits of technology

It enables early detection of pathogenic microorganisms, avoids disease outbreaks, reduces yield losses and pesticide residue risks, and provides precise prevention and control guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121472449A_ABST
    Figure CN121472449A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene detection, and provides a fluorescent quantitative PCR (polymerase chain reaction)-based primer probe group for detecting pathogenic microorganisms of root rot of Chinese chives, which comprises forward primers JBLB-F, FPLB-F and CCLB-F, reverse primers JBLB-R, FPLB-R and CCLB-R, and probes JBLB-P, FPLB-P and CCLB-P. The invention also provides a fluorescent quantitative PCR-based leek root rot pathogenic microorganism detection kit, which comprises the primer probe group. Meanwhile, the invention also provides a fluorescent quantitative PCR-based method for detecting pathogenic microorganisms of root rot of Chinese chives. Based on a probe method fluorescent quantitative PCR technology, in combination with high-sensitivity design of a specific primer probe group, accurate detection of low-copy pathogen nucleic acid can be realized, existence and quantity of pathogens can be determined in the early stage of the pathogens of the leek root rot, and early intervention and early warning of the root rot are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a primer and probe set, kit, and detection method for detecting pathogenic microorganisms of root rot in leeks based on quantitative real-time PCR. Background Technology

[0002] Chinese chives( Allium tuberosum Leeks are perennial herbaceous plants belonging to the Liliaceae family. They have a distinctive and strong aroma and possess physiological activities such as aiding digestion, lowering lipids, and reducing blood pressure, making them a popular food and medicinal vegetable. In my country, leeks are widely cultivated and have a long history of cultivation. However, in recent years, with the continuous expansion of protected cultivation areas in northern regions and the increasing number of consecutive cropping years, the cultivation of leeks by Fusarium solani (…) has become increasingly problematic. Fusarium spp. The incidence of root rot in chives caused by Fusarium wilt (also known as Fusarium) is increasing and the severity of the damage is gradually increasing. It has become one of the main soil-borne diseases that restrict the healthy and sustainable development of the chive industry and has posed a significant threat to the economic benefits of agricultural production.

[0003] As a typical soil-borne disease, leek root rot is caused by Fusarium spores (i.e., Fusarium), Fusarium spp. This fungus can survive in the soil for a long time, and once it encounters suitable temperature and humidity conditions, it easily infects the root system of chives, causing diseases. In production practice, chives are often affected by multiple diseases, with one disease affecting the other, and as the number of consecutive years of chive cultivation increases, the frequency and severity of root rot become increasingly prominent. Among them, Fusarium oxysporum (… Fusarium oxysporum Fusarium solani ( ), Fusarium solani ) and Fusarium moniliformes ( Fusarium proliferatum Root rot, whether caused by single or mixed infections, has become a key soil-borne disease restricting the large-scale, intensive production of chives. Typical symptoms include browning and rotting of the roots, necrosis of the vascular bundles, which leads to gradual yellowing of the leaves and wilting and stunting of the entire plant. Especially in continuously cropped fields or high-humidity environments, the pathogen can spread rapidly, severely damaging the absorption and transport functions of the chive root system, ultimately resulting in missing seedlings and a significant reduction in yield.

[0004] Currently, the identification of leek root rot mainly employs a combination of morphological and molecular biological methods. This involves first making a preliminary judgment based on field symptoms such as brown rot of the roots and wilting and yellowing of the plant. Then, the pathogen is isolated and cultured to observe the typical morphological characteristics of Fusarium spores, such as large and small conidia. Finally, PCR molecular detection using specific primers is used for definitive diagnosis. However, this traditional identification method has significant limitations: it is difficult to detect the pathogen in its early stages (such as when the pathogen has only infiltrated a small amount and has not yet shown typical symptoms). Diagnosis is often only possible after the disease has broken out, leading to delayed control measures and ultimately significant economic losses. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a primer and probe set, kit and detection method for detecting pathogenic microorganisms of root rot in leeks based on real-time quantitative PCR (qPCR), which can detect the presence and quantity of pathogens in the early stage of root rot in leeks (before the outbreak of root rot), so as to facilitate early intervention and early warning of root rot.

[0006] The present invention solves the above-mentioned technical problems by adopting the following technical solutions: A primer and probe set for detecting pathogenic microorganisms of leek root rot based on real-time PCR includes forward primers JBLB-F, FPLB-F, and CCLB-F, reverse primers JBLB-R, FPLB-R, and CCLB-R, and probes JBLB-P, FPLB-P, and CCLB-P. The sequence of the forward primer JBLB-F is: 5'TCAAGTCACCTATGCGAGTTC 3'; The sequence of the forward primer FPLB-F is: 5'CCTTGCTATTCCACATCGAATC 3'; The sequence of the forward primer CCLB-F is: 5'TGGAGCATCAATATGATCCGTTC 3'; The sequence of the reverse primer JBLB-R is: 5'GGTCCCATTCCATAGGTCTAG 3'; The sequence of the reverse primer FPLB-R is: 5'AATGCCCCACCAAAAAAATTAC 3'; The sequence of the reverse primer CCLB-R is: 5'CGGATTCTCACTTCTCCCATAC 3'; The sequence of probe JBLB-P is: 5'FAM-CCGCCGTCTCATACACTCCTCGCCT-BHQ1 3'; The sequence of probe FPLB-P is: 5'HEX-CTCTGCGCCCGCTTCTCCCGAGTCCCA-BHQ1 3'; The sequence of probe CCLB-P is: 5'ROX-GCGATTCAACGATGGTGGAAGCAGTGCCGA-BHQ2 3'.

[0007] As one of the preferred embodiments of the present invention, the forward primer JBLB-F and the reverse primer JBLB-R are used together to amplify the specific gene sequence of *Fusarium oxysporum*, the pathogen of leek root rot; the forward primer FPLB-F and the reverse primer FPLB-R are used together to amplify the specific gene sequence of *Fusarium solani*, the pathogen of leek root rot; the forward primer CCLB-F and the reverse primer CCLB-R are used together to amplify the specific gene sequence of *Fusarium effusum*, the pathogen of leek root rot; the specific gene sequences of *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium effusum* are shown in SEQ ID NO. 1~3, respectively.

[0008] A kit for detecting pathogenic microorganisms of root rot in leeks based on quantitative real-time PCR, the kit comprising the aforementioned primer and probe set.

[0009] As one of the preferred embodiments of the present invention, it also includes a basic reaction solution for quantitative real-time PCR.

[0010] As one of the preferred embodiments of the present invention, the basic reaction solution includes DNA polymerase, dNTPs, and Mg. 2+ Buffer solution.

[0011] As one of the preferred embodiments of the present invention, a positive standard control is also included.

[0012] As one of the preferred embodiments of the present invention, the positive standard control is a target gene sequence of the test gene derived from the genomes of Fusarium oxysporum, Fusarium solani, and Fusarium effusum; wherein, the nucleotide sequence of the target sequence corresponding to Fusarium oxysporum is shown in SEQ ID NO.1, the nucleotide sequence of the target sequence corresponding to Fusarium solani is shown in SEQ ID NO.2, and the nucleotide sequence of the target sequence corresponding to Fusarium effusum is shown in SEQ ID NO.3.

[0013] A method for detecting pathogenic microorganisms of leek root rot based on real-time quantitative PCR, using the above-mentioned primer and probe set or kit, includes the following steps: (1) Select the root of the leek as the test sample, and extract the DNA from the sample after grinding; (2) Using the DNA extracted in step (1) as a reaction template, use forward primers JBLB-F, FPLB-F, CCLB-F, reverse primers JBLB-R, FPLB-R, CCLB-R, and probes JBLB-P, FPLB-P, CCLB-P to perform real-time PCR amplification reaction; (3) Observe and analyze the detection Ct value of root rot pathogens during the quantitative real-time PCR process; when the Ct value is <39.25, it indicates that the leeks are infected with root rot.

[0014] As one of the preferred embodiments of the present invention, in step (2), the reaction system for real-time PCR is as follows: 1 μL HotStart Taq DNA polymerase, 1 μL dNTPs, 0.5 μL MgCl2 / MgSO4, 2.5 μL PCR buffer at pH 8.0, 0.5 μL each of forward primers JBLB-F, FPLB-F, and CCLB-F, 0.5 μL each of reverse primers JBLB-R, FPLB-R, and CCLB-R, 0.25 μL each of probes JBLB-P, FPLB-P, and CCLB-P, 1 μL template, and 15.25 μL H2O.

[0015] As one of the preferred embodiments of the present invention, in step (2), the fluorescence quantitative PCR reaction program is as follows: incubation at 50℃ for 2 min; pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s; annealing / extension at 60℃ for 30 s; 40 cycles.

[0016] This invention is based on probe-based qPCR. The principle is as follows: Upstream and downstream primers (i.e., forward primers JBLB-F, FPLB-F, CCLB-F; reverse primers JBLB-R, FPLB-R, CCLB-R) guide the amplification of target DNA, while fluorescently labeled probes (JBLB-P, FPLB-P, CCLB-P) bind to the middle region of the target sequence through strict complementarity. The probes are labeled with a fluorescent reporter group and a quencher group at their ends, respectively. During the PCR extension phase, the 5'→3' exonuclease activity of DNA polymerase hydrolyzes the probe, causing the reporter and quencher groups to separate and release a fluorescent signal. By monitoring the fluorescence intensity changes in each round of amplification in real time, combined with the Ct value (cycle threshold), precise quantification of the target nucleic acid is achieved. Specifically, the higher the content (copy number) of the target sequence in the test sample, the smaller the Ct value corresponding to reaching the threshold; conversely, the lower the copy number of the target sequence in the test sample, the larger the Ct value corresponding to reaching the threshold.

[0017] The advantages of this invention compared to the prior art are: (1) Outstanding early detection capability This invention is based on probe-based real-time quantitative PCR technology, combined with a highly sensitive design of specific primer and probe sets, which enables accurate detection of low-copy pathogen nucleic acids. It can identify the presence and quantity of pathogens in the early stage of leek root rot (when the pathogen has only infected a small number of people and has not yet shown typical symptoms), solving the problem that traditional morphological and molecular biological methods can only make a diagnosis after the disease has broken out. This provides key technical support for early intervention and early warning.

[0018] (2) Simultaneous detection of multiple targets with high specificity The primer and probe set of this invention is designed with specific sequences for three core pathogenic pathogens: Fusarium oxysporum, Fusarium solani, and Fusarium sp., and is paired with different fluorescently labeled probes (FAM / HEX / ROX). The detection of the three pathogens can be completed simultaneously in a single PCR reaction, avoiding missed detection of mixed infections. Moreover, after specificity verification, there is no cross-reaction with other bacteria, fungi, and viruses, and the detection results are accurate and reliable.

[0019] (3) Simple operation and intuitive quantitative analysis The detection process of this invention is standardized, eliminating the need for complex isolation and culture steps and shortening the experimental cycle. The Ct value can directly reflect the pathogen load and is positively correlated with the degree of disease infection, providing plant protection personnel with quantitative references to guide the targeted implementation of control measures.

[0020] (4) The reagent kit is highly practical and suitable for a wide range of scenarios. The kit of this invention contains a complete set of components including primer and probe sets, basic reaction solutions, and positive standard controls. No additional complicated preparation is required, and it can be used directly for rapid detection in laboratories or fields. The reaction system and program are optimized to be compatible with conventional real-time PCR instruments, and the test sample only requires leek root tissue, which is convenient to collect and suitable for multiple applications such as large-scale leek planting bases and agricultural product quality inspection institutions.

[0021] (5) Reduce production losses and pesticide residue risks This invention, through early warning and intervention, can prevent large-scale outbreaks of diseases and reduce yield losses caused by missing seedlings and broken rows; at the same time, it eliminates the need to use high doses of pesticides when diseases are severe, effectively reducing the risk of excessive pesticide residues in leeks and ensuring the quality and safety of agricultural products. Attached Figure Description

[0022] Figure 1 The figure shows the alignment results of the target sequence with Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme in Experiment Example 1. Figure 2 This is a comparison of the specific detection amplification curves of primers and probes for different pathogenic microorganism samples in Experiment Example 2, and this figure shows the detection results of Fusarium oxysporum. Figure 3 This is a comparison of the specific detection amplification curves of primers and probes for different pathogenic microorganism samples in Experiment Example 2, and this figure shows the detection results of Fusarium solani. Figure 4 This is a comparison of the specific detection amplification curves of primers and probes for different pathogenic microorganism samples in Experiment Example 2, and this figure shows the detection results of Fusarium latifolium. Figure 5 This is a photograph of the bulb of the diseased plant in Experiment Example 3; Figure 6 This is a photograph of the leaf sheath of the diseased plant in Experiment Example 3. Figure 7 This is a photograph of the roots of the diseased plant in Experiment Example 3. Figure 8 The image shows a comparison of the real-time fluorescence quantitative PCR amplification curves of Fusarium oxysporum in the following groups in Experiment Example 3: diseased plant bulb group (DV), disease-free plant bulb group (AV), diseased plant leaf sheath group (DS), disease-free plant leaf sheath group (AS), diseased plant root group (DR), disease-free plant root group (AR), diseased nutrient solution group (DW), negative control group (NC), and positive control group (AC). Figure 9 The image shows a comparison of the real-time fluorescence quantitative PCR amplification curves of Fusarium solani in the following groups in Experiment Example 3: diseased plant bulb group (DV), disease-free plant bulb group (AV), diseased plant leaf sheath group (DS), disease-free plant leaf sheath group (AS), diseased plant root group (DR), disease-free plant root group (AR), diseased nutrient solution group (DW), negative control group (NC), and positive control group (AC). Figure 10 The image shows a comparison of the real-time fluorescence quantitative PCR amplification curves of Fusarium moniliforme in the following groups in Experiment Example 3: diseased plant bulb group (DV), disease-free plant bulb group (AV), diseased plant leaf sheath group (DS), disease-free plant leaf sheath group (AS), diseased plant root group (DR), disease-free plant root group (AR), diseased nutrient solution group (DW), negative control group (NC), and positive control group (AC). Figure 11 for Figure 8 The Ct values ​​for each group in the table; Figure 12 for Figure 9 The Ct values ​​for each group in the table; Figure 13 for Figure 10 The Ct values ​​for each group are shown in the results. Detailed Implementation

[0023] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments. Furthermore, the carriers, reagents, and instruments used below, unless otherwise specified, are all conventional carriers, reagents, and instruments in the art; the experimental methods used, unless otherwise specified, are all conventional methods in the art and will not be described further.

[0024] Example 1 This embodiment presents a primer and probe set for detecting pathogenic microorganisms of leek root rot based on real-time PCR, including forward primers JBLB-F, FPLB-F, and CCLB-F, reverse primers JBLB-R, FPLB-R, and CCLB-R, and probes JBLB-P, FPLB-P, and CCLB-P.

[0025] The sequence of the forward primer JBLB-F is: 5'TCAAGTCACCTATGCGAGTTC 3'; The sequence of the forward primer FPLB-F is: 5'CCTTGCTATTCCACATCGAATC 3'; The sequence of the forward primer CCLB-F is: 5'TGGAGCATCAATATGATCCGTTC 3'; The sequence of the reverse primer JBLB-R is: 5'GGTCCCATTCCATAGGTCTAG 3'; The sequence of the reverse primer FPLB-R is: 5'AATGCCCCACCAAAAAAATTAC 3'; The sequence of the reverse primer CCLB-R is: 5'CGGATTCTCACTTCTCCCATAC 3'; The sequence of probe JBLB-P is: 5'FAM-CCGCCGTCTCATACACTCCTCGCCT-BHQ1 3'; The sequence of probe FPLB-P is: 5'HEX-CTCTGCGCCCGCTTCTCCCGAGTCCCA-BHQ1 3'; The sequence of probe CCLB-P is: 5'ROX-GCGATTCAACGATGGTGGAAGCAGTGCCGA-BHQ2 3'.

[0026] The forward primer JBLB-F and the reverse primer JBLB-R are used together to amplify the pathogen of leek root rot, Fusarium oxysporum (JB). Fusarium oxysporum The specific gene sequence of ) (SEQ ID NO.1); the forward primer FPLB-F and the reverse primer FPLB-R were used together to amplify the pathogen of leek root rot - Fusarium solani ( Fusarium solani The specific gene sequence of ) (SEQ ID NO.2); the forward primer CCLB-F and the reverse primer CCLB-R were used together to amplify the pathogen of leek root rot - Fusarium moniliforme ( Fusarium proliferatum The specific gene sequence of ) (SEQ ID NO.3).

[0027] Example 2 This embodiment presents a detection kit for pathogenic microorganisms of leek root rot based on real-time PCR, comprising: forward primers (JBLB-F, FPLB-F, CCLB-F), reverse primers (JBLB-R, FPLB-R, CCLB-R), probes (JBLB-P, FPLB-P, CCLB-P), Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, PCR buffer (pH 8.0), and positive standard control.

[0028] The forward primers (JBLB-F, FPLB-F, CCLB-F), reverse primers (JBLB-R, FPLB-R, CCLB-R), and probes (JBLB-P, FPLB-P, CCLB-P) are as shown in Example 1.

[0029] Hot Start Taq DNA polymerase, dNTPs, MgCl2 / MgSO4, and PCR buffer are commercially available products.

[0030] The positive standard control consists of target gene sequences derived from the genomes of *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium effusum*. The nucleotide sequences of the target sequences for *Fusarium oxysporum* are shown in SEQ ID NO.1, those for *Fusarium solani* are shown in SEQ ID NO.2, and those for *Fusarium effusum* are shown in SEQ ID NO.3. All sequences were synthesized using gene synthesis methods, and the gene synthesis process can be outsourced to Beijing Qingke Biotechnology Co., Ltd.

[0031] Example 3 This embodiment presents a method for detecting pathogenic microorganisms of leek root rot based on real-time PCR, using the detection kit from Example 2, and includes the following steps: (1) Select the root of the leek as the test sample. After grinding with liquid nitrogen, extract its DNA using a DNA extraction kit (Yisheng Bio Bacterial / Fungal DNA Kit Magnetic Bead Method Bacterial / Fungal DNA Extraction Kit).

[0032] (2) Using the DNA extracted in step (1) as a template, a real-time PCR amplification reaction was performed using forward primers JBLB-F, FPLB-F, and CCLB-F, reverse primers JBLB-R, FPLB-R, and CCLB-R, and probes JBLB-P, FPLB-P, and CCLB-P. The qPCR reaction system is shown in Table 1, and the qPCR reaction procedure is shown in Table 2.

[0033] Table 1 qPCR reaction system

[0034] Table 2 qPCR reaction procedure

[0035] (3) Observe and analyze the detection Ct value of root rot pathogens during the quantitative real-time PCR process; when the Ct value is <39.25, it indicates that the leeks are infected with root rot.

[0036] Example 4 The method for detecting pathogenic microorganisms of leek root rot based on real-time PCR in this embodiment is basically the same as that in Example 3, except that “MgCl2” in the qPCR reaction system is replaced by “MgSO4”.

[0037] Experimental Example 1 This experimental example is used to describe the screening process of the target sequences of the present invention, so as to reflect the specificity of the target gene sequences corresponding to the primers and probes of the present invention.

[0038] The genomic sequences of *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium effusum* were downloaded from the NCBI database, and sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 were selected as target gene sequences. Comparison with the NCBI database showed that these target sequences had a high alignment rate and good specificity with *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium effusum*. Figure 1 As shown.

[0039] When this target sequence was compared with other types of microbial genome sequences, its coverage and specificity showed significant differences, thus this sequence has the potential to be used as a detection target sequence.

[0040] Experimental Example 2 This experimental example compares the specificity of the primer probe for detecting the pathogenic microorganism of leek root rot with other types of pathogenic microorganisms, revealing the specificity of the primer probe of this invention for detecting the pathogenic microorganism of leek root rot.

[0041] I. Experimental Methods To verify the specificity of the primer and probe of this invention, in addition to the pathogenic microorganisms of leek root rot—Fusarium oxysporum, Fusarium solani, and Fusarium solani—common bacterial and fungal samples such as Escherichia coli (E. coli), Botrytis cinerea (BS), Vibrio cholerae (VC standard), and Staphylococcus aureus (SA) were selected. Viral samples such as respiratory syncytial virus (RSV), influenza A virus (FLUA), human rhinovirus (HRV), human parainfluenza virus (HPIV), SARS-CoV-2 pseudovirus standard, and influenza B virus (FLUB) were also selected. The primer and probe set designed in this invention (Example 1) was used for detection.

[0042] II. Test Results The results are as follows Figures 2-4 As shown in the figure (PC is the positive control).

[0043] The results showed that, apart from the detection of the pathogens causing root rot in chives (Fusarium oxysporum, Fusarium solani, and Fusarium cystis), no other bacteria, fungi, or viruses were detected in the samples. This is consistent with the results showing that only the target nucleic acid fragments of Fusarium oxysporum, Fusarium solani, and Fusarium cystis were amplified in environmental macromicrobial samples, proving that the primers and probes designed in this invention have high specificity.

[0044] Experimental Example 3 This experiment was conducted to investigate the transmission pathways and infection cycles of root rot fungi in a hydroponic leek greenhouse, and to verify the feasibility of the method of this invention.

[0045] I. Experimental Methods First, suspected root rot-infected leek plants with yellowing and wilting leaves, softened and rotten stem bases oozing mucus and emitting a foul odor were selected from the leek greenhouse, along with healthy plants. Root samples from diseased plants were collected, ground, and microbial DNA extracted. Metagenomic high-throughput sequencing and bioinformatics analysis confirmed that the main pathogens in the samples were *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium solani*. Subsequently, the samples were divided into four groups: diseased plant bulbs, healthy plant bulbs, diseased plant leaf sheaths, healthy plant leaf sheaths, diseased plant roots, and healthy plant roots. Specific groupings are detailed in Table 3.

[0046] Table 3 Sample Grouping

[0047] Next, the tissues (bulb, leaf sheath, and root) of each group were ground separately, and the nucleic acids of the symbiotic microorganisms were extracted using a DNA extraction kit (Yisheng Bio Bacterial / Fungal DNA Kit with magnetic beads). Simultaneously, samples were also taken from each nutrient solution to extract their nucleic acids (using the same DNA extraction kit as before).

[0048] Finally, using the extracted DNA as a template, real-time quantitative PCR amplification was performed using the kit of the present invention (Example 2) (using a quantitative PCR instrument) to detect the content of root rot fungi in different tissue parts and nutrient solutions (the reaction system and reaction procedure are specifically referred to Example 3).

[0049] II. Test Results Figures 8-10A comparison of amplification curves for diseased plant bulbs (DV), disease-free plant bulbs (AV), diseased plant leaf sheaths (DS), disease-free plant leaf sheaths (AS), diseased plant roots (DR), disease-free plant roots (AR), diseased nutrient solution (DW), negative control group (NC), and positive control group (AC). Figures 11-13 The results are the Ct values ​​for each group.

[0050] III. Statistical Analysis of Results The statistical analysis of the results is shown in Tables 4-6.

[0051] Table 4. Statistical analysis of Fusarium oxysporum samples.

[0052] Note: A positive result is determined by the detection of Ct value in any one of the three technical replicates.

[0053] Table 5. Statistical analysis of Fusarium solani samples.

[0054] Note: A positive result is determined by the detection of Ct value in any one of the three technical replicates.

[0055] Table 6. Statistical Analysis of Fusarium solani samples.

[0056] Note: A positive result is determined by the detection of Ct value in any one of the three technical replicates.

[0057] From the above results, we can conclude that: (1) The test results varied greatly among different parts of the same leek plant. The Ct value of the samples from the leaf sheath of the leek was relatively high, indicating that the pathogen load in these parts was not high and that they were not the main parasitic sites for Fusarium oxysporum, Fusarium solani, and Fusarium moniliforme. The root is the main parasitic site for root rot pathogens. The main routes of transmission of root rot among leeks are through rainwater, irrigation water, fertilizer, and insects. Therefore, when testing for root rot in leeks, the root of the leek should be taken as the test sample.

[0058] (2) When the Ct value of the root rot fungus in the leek sample is less than 39.25, the leek is infected with root rot and needs to be noticed by plant protection personnel. An outbreak of root rot in leeks will affect the growth of leeks and plant protection personnel need to take immediate measures to treat it in order to avoid greater losses.

[0059] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer and probe set for detecting pathogenic microorganisms of leek root rot based on real-time quantitative PCR, characterized in that, This includes forward primers JBLB-F, FPLB-F, and CCLB-F; reverse primers JBLB-R, FPLB-R, and CCLB-R; and probes JBLB-P, FPLB-P, and CCLB-P. The sequence of the forward primer JBLB-F is: 5'TCAAGTCACCTATGCGAGTTC 3'; The sequence of the forward primer FPLB-F is: 5'CCTTGCTATTCCACATCGAATC 3'; The sequence of the forward primer CCLB-F is: 5'TGGAGCATCAATATGATCCGTTC 3'; The sequence of the reverse primer JBLB-R is: 5'GGTCCCATTCCATAGGTCTAG 3'; The sequence of the reverse primer FPLB-R is: 5'AATGCCCCACCAAAAAAATTAC 3'; The sequence of the reverse primer CCLB-R is: 5'CGGATTCTCACTTCTCCCATAC 3'; The sequence of probe JBLB-P is: 5'FAM-CCGCCGTCTCATACACTCCTCGCCT-BHQ1 3'; The sequence of probe FPLB-P is: 5'HEX-CTCTGCGCCCGCTTCTCCCGAGTCCCA-BHQ1 3'; The sequence of probe CCLB-P is: 5'ROX-GCGATTCAACGATGGTGGAAGCAGTGCCGA-BHQ2 3'.

2. The primer-probe set according to claim 1, characterized in that, The forward primer JBLB-F and the reverse primer JBLB-R are used together to amplify the specific gene sequence of *Fusarium oxysporum*, the pathogen of leek root rot; the forward primer FPLB-F and the reverse primer FPLB-R are used together to amplify the specific gene sequence of *Fusarium solani*, the pathogen of leek root rot; the forward primer CCLB-F and the reverse primer CCLB-R are used together to amplify the specific gene sequence of *Fusarium effusum*, the pathogen of leek root rot; the specific gene sequences of *Fusarium oxysporum*, *Fusarium solani*, and *Fusarium effusum* are shown in SEQ ID NO. 1 to 3, respectively.

3. A detection kit for pathogenic microorganisms of leek root rot based on real-time quantitative PCR, characterized in that, The kit contains the primer and probe set as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, It also includes basic reaction solutions for quantitative real-time PCR.

5. The reagent kit according to claim 4, characterized in that, The basic reaction solution includes DNA polymerase, dNTPs, and Mg. 2+ Buffer solution.

6. The reagent kit according to claim 3, characterized in that, It also includes positive standard controls.

7. The reagent kit according to claim 6, characterized in that, The positive standard control is a target gene sequence derived from the genomes of Fusarium oxysporum, Fusarium solani, and Fusarium effusum; wherein the nucleotide sequence of the target sequence corresponding to Fusarium oxysporum is shown in SEQ ID NO.1, the nucleotide sequence of the target sequence corresponding to Fusarium solani is shown in SEQ ID NO.2, and the nucleotide sequence of the target sequence corresponding to Fusarium effusum is shown in SEQ ID NO.

3.

8. A method for detecting pathogenic microorganisms of leek root rot based on quantitative real-time PCR, characterized in that, Using the primer and probe set according to any one of claims 1 to 2, or the kit according to any one of claims 3 to 7, the method includes the following steps: (1) Select the root of the leek as the test sample, and extract the DNA from the sample after grinding; (2) Using the DNA extracted in step (1) as a reaction template, use forward primers JBLB-F, FPLB-F, CCLB-F, reverse primers JBLB-R, FPLB-R, CCLB-R, and probes JBLB-P, FPLB-P, CCLB-P to perform real-time PCR amplification reaction; (3) Observe and analyze the detection Ct value of root rot pathogens during the quantitative real-time PCR process; when the Ct value is <39.25, it indicates that the leeks are infected with root rot.

9. The detection method according to claim 8, characterized in that, In step (2), the reaction system for real-time PCR is as follows: 1 μL Hot Start Taq DNA polymerase, 1 μL dNTPs, 0.5 μL MgCl2 / MgSO4, 2.5 μL PCR buffer at pH 8.0, 0.5 μL each of forward primers JBLB-F, FPLB-F, and CCLB-F, 0.5 μL each of reverse primers JBLB-R, FPLB-R, and CCLB-R, 0.25 μL each of probes JBLB-P, FPLB-P, and CCLB-P, 1 μL template, and 15.25 μL H2O.

10. The detection method according to claim 8, characterized in that, In step (2), the fluorescence quantitative PCR reaction program is as follows: incubation at 50℃ for 2 min; pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 15 s; annealing / extension at 60℃ for 30 s; 40 cycles.

Citation Information

Patent Citations

  • Method and primer composition for detecting soybean fusarium oxysporum based on LAMP (loop-mediated isothermal amplification) technology

    CN103352078A

  • Nucleic acid, kit and method for simultaneously detecting valsa ceratosperma, yellows phytoplasma and rosette pathogenic bacteria

    CN107604091A

  • Rapid and accurate detection method for Fusarium oxysporum based on RPA (recombinase polymerase amplification)-lateral flow chromatography test strip technology

    CN109897910A

  • Specific detection target FPRO_09882 of fusarium laminatum and application thereof

    CN114032331A

  • Primer probe group, kit and detection method for detecting pathogenic bacteria through multiple qPCR (quantitative polymerase chain reaction)

    CN116024371A