Primer combination and kit for detecting hepatitis A virus and application of primer combination and kit
By designing primer combinations targeting the conserved region at the junction of HAV 5'UTR and VP1, optimizing primer sequences and amplification parameters, and combining them with real-time PCR technology, the low detection rate and false positive problems of hepatitis A virus detection in existing technologies have been solved, enabling accurate detection of early low-load HAV samples. This method is suitable for epidemiological surveys and special sample detection.
Patent Information
- Application Number
- CN202511956468.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-23
- Publication Date
- 2026-03-03
AI Technical Summary
Existing hepatitis A virus PCR detection technologies suffer from problems such as low detection rate of non-type I genotypes, high false positive rate, and insufficient detection capacity for low viral loads.
We designed primer combinations targeting the conserved region at the junction of HAV 5'UTR and VP1, optimized primer sequences and amplification parameters, and combined them with real-time PCR technology to achieve high sensitivity and specificity for the detection of HAV RNA.
It enables accurate detection of early low-load HAV samples, eliminates missed detections during the window period, and improves the accuracy and specificity of detection, making it suitable for epidemiological investigations and special sample testing.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer combination, reagent kit, and application for detecting hepatitis A virus. Background Technology
[0002] Hepatitis A virus (HAV) is a single-stranded, positive-sense RNA virus belonging to the genus *Hepatovirae* of the family Picornaviridae. Its genome is approximately 7.5 kb in length and contains a 5' untranslated region (5'UTR), an open reading frame (encoding structural proteins VP1-VP4 and non-structural proteins 2A-3D), and a 3' untranslated region (3'UTR). HAV is primarily transmitted via the fecal-oral route. Infection can cause acute hepatitis, with clinical manifestations including fever, fatigue, jaundice, and elevated liver enzymes. Some severe cases can progress to liver failure, with the risk being higher in the elderly or immunocompromised individuals.
[0003] From a public health and clinical diagnostic perspective, HAV testing has three core needs: 1) Early diagnosis: After HAV infection, the viremia phase (1-7 days post-infection) occurs earlier than the antibody production phase (IgM antibodies usually appear 1-2 weeks after the onset of illness). Early detection of viral RNA can avoid missed detection during the "window period" of antibody testing; 2) Genotyping to aid epidemiological investigation: HAV is divided into 7 genotypes, I-VII, with genotype I being the globally dominant genotype. Tracing the transmission chain of different genotypes requires accurate viral nucleic acid testing; 3) Special sample testing: In addition to serum, the detection of HAV in samples such as feces and saliva is crucial for screening for asymptomatic infections (approximately 30%-50% of HAV infections are asymptomatic and can only be detected through nucleic acid testing). Currently, HAV testing technologies are mainly divided into two categories: antibody detection technologies (mainly enzyme-linked immunosorbent assay ELISA) and nucleic acid detection technologies (mainly polymerase chain reaction PCR). Among them, PCR technology has become the "gold standard" for clinical diagnosis of HAV due to its high sensitivity, strong specificity and early detection. The core of PCR detection lies in primer design - the conservation of the primer's target region, sequence specificity and amplification efficiency directly determine the detection performance.
[0004] However, existing PCR detection techniques for hepatitis A virus still have some limitations. Current primers mostly target the HAV VP2 or 3'UTR region, and these regions share only 85%-90% sequence homology across different HAV genotypes (I-VII) (e.g., the VP2 region differs by more than 10 bases between genotypes I and II), resulting in low detection rates for non-genotype I. Some existing primers (such as those targeting the 3'UTR region) share consecutive 12-14 bp homologous sequences with other hepatitis viruses or enteroviruses, easily leading to false positives. Furthermore, viral load in early HAV infection samples is often 50-100 copies / mL, and current protocols are insufficient for detecting low viral loads. Summary of the Invention
[0005] This invention aims to address at least one of the technical problems existing in the prior art. To this end, this invention proposes a primer combination for detecting hepatitis A virus. This primer combination, through targeted region optimization, sequence design improvement, and amplification parameter matching, solves the core pain points of existing HAV detection technologies and has higher application value in clinical diagnosis and quality testing of cell therapy products.
[0006] The present invention also proposes a reagent kit.
[0007] This invention also proposes applications of the above primer combinations or kits.
[0008] This invention also proposes a method for detecting hepatitis A virus.
[0009] According to a first aspect of the present invention, a primer combination for detecting hepatitis A virus is provided, said primer combination comprising at least one of the following combinations: (a) Forward primer SEQ ID NO:3 and reverse primer SEQ ID NO:4; (b) Forward primer SEQ ID NO:5 and reverse primer SEQ ID NO:6.
[0010] According to a second aspect of the present invention, a kit is provided comprising the primer combination described in the first aspect of the present invention.
[0011] In some embodiments of the present invention, the kit further includes probes, the probes including at least one of SEQ ID NO:7 and SEQ ID NO:8.
[0012] In some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent group and the 3' end is labeled with a fluorescence quenching group.
[0013] In some embodiments of the present invention, the fluorescent group includes any one of FAM, HEX, ROX, VIC, Cy3, and Cy5.
[0014] In some embodiments of the present invention, the fluorescence quenching group includes any one of BHQ1, BHQ2 and TAMRA.
[0015] In some embodiments of the present invention, the kit further includes a fluorescent PCR reaction solution and a buffer solution.
[0016] According to a third aspect of the present invention, the application of the primer combination described in the first aspect of the present invention or the kit described in the second aspect of the present invention in the preparation of products for detecting hepatitis A virus is proposed.
[0017] According to a fourth aspect of the present invention, a method for detecting hepatitis A virus is provided, the method comprising the following steps: detecting the sample to be tested using the primer combination described in the first aspect of the present invention or the kit described in the second aspect of the present invention.
[0018] In some embodiments of the present invention, the detection is performed using quantitative real-time PCR.
[0019] In some embodiments of the present invention, the amplification reaction system of the real-time PCR is 10-20 µL, specifically comprising the following components: 2 × 5-10 µL of fluorescent PCR reaction solution; Forward primer 0.3-0.7 μM; Reverse primer 0.3-0.7 μM; 2-8 µL of sample to be tested; Buffer solution 2-3 µL.
[0020] In some embodiments of the present invention, the amplification reaction system of the real-time PCR is 10-20 µL, specifically comprising the following components: 2 × 5-10 µL of fluorescent PCR reaction solution; Forward primer 0.3-0.7 μM; Reverse primer 0.3-0.7 μM; Probe 0.1-0.5 μM; 2-8 µL of sample to be tested; Buffer solution 2-3 µL.
[0021] In some embodiments of the present invention, the buffer solution includes Buffer TE.
[0022] In some embodiments of the present invention, the amplification program of the real-time PCR is as follows: pre-denaturation at 48-52℃ for 1-3 min; pre-denaturation at 94-96℃ for 1-3 min; denaturation at 94-96℃ for 12-18 s, annealing at 50-60℃ for 28-32 s, extension at 70-74℃ for 28-32 s, 35-45 cycles, and fluorescence data are collected at 70-74℃.
[0023] The present invention has at least the following beneficial effects: 1) The primer combination provided by this invention, through the combination design of "conserved region targeting + short fragment amplification", can achieve a detection limit of 3.9 copies / mL for HAV RNA, which can effectively detect low-load samples in the early stage of HAV infection and eliminate missed detection during the "window period".
[0024] 2) The two primer pairs provided by this invention can be used independently (with an accuracy of ≥95% when used alone) or in combination for multiplex PCR detection. By using the matching fluorescent probes, different fragments of the conserved region of HAV can be amplified by dual PCR, which further reduces the risk of missed detection due to accidental mutations of a single primer and improves the accuracy of combined detection to over 99%.
[0025] 3) The primer combination provided by this invention covers a more comprehensive range of genotypes; existing primers do not mention whether they can detect the homology of different HAV genotypes, while the primers of this invention target the highly conserved region at the junction of 5'UTR and VP1 (homology ≥95%), which can completely eliminate missed detections caused by genotype differences, and are especially suitable for screening "unknown genotype HAV" in epidemiological surveys.
[0026] 4) The primers of this invention showed no cross-reactive sequences after BLAST alignment, and experimental verification showed that they could not detect DNA from other species, demonstrating good specificity. Attached Figure Description
[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is a melting curve of primer P1-F1 / R1 in the experimental examples of this invention; Figure 2 This is a melting curve of primer P1-F3 / R3 in the experimental examples of this invention; Figure 3 This is a melting curve of the HAV-U primers in the experimental examples of this invention; Figure 4 This is a melting curve of the HAV-V primers in the experimental examples of this invention; Figure 5 This is an amplification curve of HAV-U primers in the experimental examples of this invention. Detailed Implementation
[0028] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0029] The commercial information for the reagents used in the following examples and test cases is shown in Table 1. Additionally, unless otherwise specified, all instruments and reagents used are commercially available through regular purchasing channels.
[0030] Table 1 Information on reagents used
[0031] Example 1 This embodiment provides a primer combination for hepatitis A virus, and the primer screening method is as follows: Based on the whole genome sequence of HAV strain ATCC_VR-1402, specific primers were designed targeting the conserved region at the junction of the 5'UTR and VP1 genes in the HAV genome. This region exhibits ≥95% sequence homology and has no genotype-specific variant sites, thus providing 100% coverage of all HAV genotypes and fundamentally solving the problem of incomplete genotype coverage by existing primers. All primers underwent structural optimization (length 19-24 bp, ΔG > -5 kcal / mol, no consecutive complementary bases at the 3' end) to avoid non-specific amplification and primer dimer formation. Simultaneously, BLAST alignment was used to ensure that the primers showed <65% homology with other viral genomes (HBV, HCV, HDV, HEV) and <55% homology with the human genome, avoiding cross-reactions and ensuring high specificity. Furthermore, the PCR product length of all primers was controlled below 300 bp; short fragments reduce the impact of RNA template degradation on amplification, significantly improving the detection success rate of low-load samples. The final primer sequences are shown in Table 2.
[0032] The P1 target fragment 1 sequence targeting the conserved region at the junction of the 5'UTR and VP1 gene in the HAV genome is: 5'-CAGACCTCTCTGTGCTTGGGGCAAACATCATTTGGCCTTAAATGGGATTCTGTGAGAGGGGATCCCTCCATTGCCAGCTGGACTGTTCTTTGGGGCCTTATGTGGTGTTTGCCGCTGAGGTACTCAG-3' (SEQ ID NO:1); this target fragment corresponds to P1-F1 / R1 in Table 2; The sequence of target fragment 2 of P1 is: 5'-GGGTAGGCTACGGGTGAAACCTCTTAGGCTAATACTTCTATGAAGAGATGCCTTGGATAGGGTAACAGCGGCGGATATTGGTGAGTTGTTAAGACAAAAACCATTCAACGCCGGAGGACTGACTCTCATCCAGTGGATGCATTGAGTGGATTGACTGTCGGGGCTGTCTTTAGG-3' (SEQ ID NO:2); this target fragment corresponds to P1-F3 / R3 in Table 2.
[0033] Table 2 Primer sequences of Example 1
[0034] According to calculations using OligoCalc software, the Tm values of both primer pairs were controlled within the range of 57.8℃-58.8℃ (P1-F1Tm≈58.2℃, P1-R1Tm≈58.5℃, P1-F3Tm≈57.8℃, P1-R3Tm≈58.8℃), with a Tm value difference of ≤1℃. This allows for efficient amplification under uniform PCR reaction conditions (annealing temperature 58℃), avoiding "single primer amplification" or "uneven amplification efficiency" caused by Tm value differences. At the same time, the primer amplification product lengths were optimized to 180 bp (P1-F1 / P1-R1) and 220 bp (P1-F3 / P1-R3). The short fragment products can reduce the impact of RNA template degradation on amplification and significantly improve the detection success rate of low-load samples.
[0035] Example 2 This embodiment provides a method for detecting hepatitis A virus. This method is based on the primer combination provided in Embodiment 1 and includes the following steps: The test samples were resuspended in Buffer TE to a final volume of 4 μL, and the reaction mixture was prepared according to the formulation shown in Table 3. The same template was used for replicate reactions. All reactions were performed on an automated medical PCR analysis system (Sansure Biotech, SLAN-96P). The real-time quantitative PCR reaction program was as follows: 50℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 40 cycles. Fluorescence signals were acquired at 72℃. A positive control and a negative control were set up, with the positive control consisting of 1.3 × 10⁻⁶ samples. 10 The standard for the target HAV fragment (corresponding to the gene fragment shown in SEQ ID NO:1 or SEQ ID NO:2) is 1 / mL, and the negative control is DEPC water.
[0036] Table 3 PCR reaction system
[0037] Judgment criteria: The experiment is valid if the positive control Ct value is ≤38, the negative control Ct value is >38, or there is no Ct value. A sample with a Ct value ≤ 38 is considered positive. The absence of typical "S"-type amplification or a Ct value ≥40 indicates a negative result. If the Ct value is 38 < Ct < 40, the result is considered suspicious and needs to be retested; if the result is still 38 < Ct ≤ 40, the result is reported as negative.
[0038] Example 3 This embodiment provides a kit for detecting hepatitis A virus, which includes the following components: primer combinations provided in Example 1 (with sequences as shown in SEQ ID NO:1-4 respectively), and 2×ArtiCan fluorescent PCR reaction solution. ATM SYBR qPCR Mix, positive control HAV target fragment standard (corresponding to the gene fragment shown in SEQ ID NO:1 or SEQ ID NO:2), DEPC water, and Buffer TE.
[0039] Example 4 This embodiment provides a primer-probe combination for hepatitis A virus, including the primer combination and corresponding fluorescent probe provided in Example 1.
[0040] The design principles of the probe are: 1) Probe location: All probes are located between the binding regions of the corresponding forward and reverse primers to ensure that they bind to the template only when PCR amplifies specific fragments.
[0041] 2) Sequence specificity: The probe sequence originates from the conserved middle region of the target fragment, has no self-complementary secondary structure, and has no obvious complementarity with the primer.
[0042] 3) Label selection: The 5' end uses a commonly used fluorescent reporter group (FAM / VIC, which can distinguish between the two groups of detection), and the 3' end uses a BHQ1 quencher group to avoid interference from fluorescence background.
[0043] 4) Tm value and GC content: The Tm value is optimized to be higher than that of the primer (primer Tm is usually 55-65℃) to ensure that the probe binds to the template preferentially during the annealing stage, and the GC content is in the optimal range to ensure binding stability.
[0044] The probe information obtained from the design is shown in Table 4.
[0045] Table 4 Fluorescent probe sequence information
[0046] Comparative Example 1 This comparative example provides a primer combination for hepatitis A virus, which is a primer combination designed in the same batch as Example 1 but does not meet the primer design principles of Example 1. The primer sequences are shown in Table 5.
[0047] Table 5 Primer sequences of Comparative Example 1
[0048] Test case This experiment tested the detection performance of the primer combinations provided in Example 1 and Comparative Example 1. The specific experimental methods and results are as follows: 1. Primer specificity: 1) Melting curves of the two sets of primers in Example 1: The quantitative standard was a plasmid containing the HAV target fragment. 4 μg of plasmid was reconstituted with 1 mL of Buffer TE to obtain an initial concentration of 1.3 × 10⁻⁶. 12 The quantitative standard stock solution was prepared in copies / mL. The quantitative standard stock solution was diluted with Buffer TE according to Table 6. Then, the PCR reaction system was prepared and PCR was performed using the detection method provided in Example 2. The results are shown below. Figure 1 and Figure 2 As shown.
[0049] Table 6 Dilution Protocols for Quantitative Standards
[0050] Depend on Figure 1 and Figure 2 It can be seen that the melting curves of primers P1-F1 / R1 and P1-F3 / R3 provided in Example 1 are both single peaks, indicating that no primer dimers or non-specific amplification occurred, and the two sets of primers provided in Example 1 have good specificity.
[0051] 2) Specificity of the two sets of primers in Example 1 in detecting DNA from different pathogens: DNA was extracted from different samples according to the following experimental steps: Human mesenchymal stem cell (Hu-MSC) DNA, Escherichia coli DNA, Mycoplasma pneumoniae DNA, and JCV virus DNA were extracted using the Tiangen DP304 reagent kit. The cell count was 1×10⁶ cells / year. 6For cell samples or 200 μL of cell-free samples (Escherichia coli, Mycoplasma pneumoniae, and JCV virus), ① add 200 μL of buffer GA and vortex until completely resuspended; ② add 20 μL of Proteinase K solution and mix well; ③ add 200 μL of buffer GB, mix thoroughly by inverting, incubate at 70°C for 10 min until the solution becomes clear, and briefly centrifuge for about 15 s using a handheld centrifuge; ④ add 200 μL of anhydrous ethanol, mix thoroughly by inverting for 15 s, and briefly centrifuge for about 15 s using a handheld centrifuge; ⑤ add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 s, and discard the waste liquid; ⑥ add 500 μL of buffer GD to the adsorption column CB3 (confirm that anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 s, and discard the waste liquid; ⑦ add 600 μL of buffer GD to the adsorption column CB3. 8. Add μL of PW wash buffer (confirm anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 s, and discard the waste liquid; 9. Repeat step 7; 10. Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column CB3 at room temperature for 5 minutes; 11. Transfer the adsorption column CB3 into a clean centrifuge tube, add 50 μL of elution buffer TE dropwise to the middle of the adsorption membrane, place at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min, and collect the solution in the centrifuge tube. Measure the DNA concentration of the sample using a micro spectrophotometer, and take 100 ng of DNA for subsequent detection. The PCR reaction system was prepared and PCR was performed using the detection method provided in Example 2. The results are shown in Table 7.
[0052] Table 7. DNA detection results from different species
[0053] As shown in Table 7, the primers P1-F1 / R1 and P1-F3 / R3 provided in Example 1 only specifically amplify hepatitis A virus and do not recognize DNA from other sources, thus exhibiting good detection specificity.
[0054] 2. Determination of the detection limit: 1) The quantitative standard is a plasmid containing the HAV target fragment. 4 μg of plasmid was reconstituted with 1 mL of Buffer TE to obtain an initial concentration of 1.3 × 10⁻⁶. 12 The quantitative standard stock solution was prepared in copies / mL. The quantitative standard stock solution was diluted with Buffer TE according to Table 8. Then, the PCR reaction system was prepared and PCR was performed using the detection method provided in Example 2. The results are shown in Table 9.
[0055] Table 8 Dilution Protocols for Quantitative Standards
[0056] Table 9. Detection results of positive control standards at different concentrations
[0057] As shown in Table 9, the detection limits of both primer pairs provided in Example 1 for HAV virus are 3.9 copies / mL, and both primer pairs have high sensitivity.
[0058] 3. Test the detection performance of the primers provided in Comparative Example 1. The quantitative standard was purchased from Beina Biotechnology's inactivated hepatitis A virus RNA standard, with a specification of (5.0±1.5)×10⁻⁶. 7 Copies / mL, 0.1 mL / tube, Catalog No.: BNCC369773. Reverse transcription of this RNA standard was performed using a reverse transcription kit (Beijing Qingke Biotechnology, TSK302M). Remove gDNA remover, 10× gDNAremover Buffer, and RNase-free water from the reverse transcription kit, thaw on ice, and centrifuge briefly for a few seconds before use. Prepare the reverse transcription reaction system according to the formula in Table 10 using an eight-tube qPCR kit.
[0059] Table 10 Reverse Transcription System
[0060] Gently mix the reverse transcription system with a pipette tip, briefly centrifuge, and incubate at 42°C for 2 min, followed by incubation at 60°C for 5 min. Quickly cool the reverse transcription system on ice, briefly centrifuge, and add the components shown in Table 11. Gently mix with a pipette tip, briefly centrifuge, and proceed with the reverse transcription reaction according to the reaction conditions shown in Table 12.
[0061] Table 11 Reverse Transcription System
[0062] Table 12 Reverse Transcription Reaction Conditions
[0063] The total PCR reaction volume was 10 μL, including 2× ArtiCan ATM5 μL of SYBR qPCR Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer (10 μM), and 4 μL of cDNA from the sample to be tested were used. The final concentrations of both upstream and downstream primers were 0.5 μM. The same template was used for replicate reactions, and all reactions were performed on a LightCycler 480 real-time PCR instrument. The real-time PCR reaction program was: 50℃ pre-denaturation for 2 min; 95℃ pre-denaturation for 2 min; 95℃ denaturation for 15 s; 60℃ annealing and extension for 30 s, for a total of 40 cycles. Fluorescence signals were acquired at 60℃. The results are shown below. Figures 3-5 As shown.
[0064] Depend on Figures 3-5 It can be seen that neither HAV-U nor HAV-V has a CT value; the HAV-U primer melting curve is a single peak, but the fluorescence intensity is low, indicating that the PCR product is not the target gene fragment; the HAV-V primer melting curve has no peak, indicating that the specific fragment cannot be amplified. Neither of the primer sets provided in Comparative Example 1 is suitable for the detection of HAV.
[0065] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A primer combination for detecting hepatitis A virus, characterized in that, The primer combination includes at least one of the following combinations: (a) Forward primer SEQ ID NO:3 and reverse primer SEQ ID NO:4; (b) Forward primer SEQ ID NO:5 and reverse primer SEQ ID NO:
6.
2. A reagent kit, characterized in that, The kit comprises the primer combination as described in claim 1.
3. The reagent kit according to claim 2, characterized in that, The kit also includes probes, which include at least one of SEQ ID NO:7 and SEQ ID NO:
8.
4. The reagent kit according to claim 3, characterized in that, The probe is labeled with a fluorescent group at its 5' end and a fluorescence quenching group at its 3' end; Preferably, the fluorescent group includes any one of FAM, HEX, ROX, VIC, Cy3, and Cy5; Preferably, the fluorescence quenching group includes any one of BHQ1, BHQ2, and TAMRA.
5. The primer combination of claim 1 or the kit of any one of claims 2-4 is used in the preparation of a product for detecting hepatitis A virus.
6. A method for detecting hepatitis A virus, characterized in that, The detection method includes the following steps: using the primer combination of claim 1 or the kit of any one of claims 2-4 to detect the sample to be tested.
7. The detection method according to claim 6, characterized in that, The detection was performed using quantitative real-time PCR.
8. The detection method according to claim 7, characterized in that, The amplification reaction system for the quantitative real-time PCR is 10-20 µL, and specifically includes the following components: 2 × 5-10 µL of fluorescent PCR reaction solution; Forward primer 0.3-0.7 μM; Reverse primer 0.3-0.7 μM; 2-8 µL of sample to be tested; Buffer solution 2-3 µL.
9. The detection method according to claim 7, characterized in that, The amplification reaction system for the quantitative real-time PCR is 10-20 µL, and specifically includes the following components: 2 × 5-10 µL of fluorescent PCR reaction solution; Forward primer 0.3-0.7 μM; Reverse primer 0.3-0.7 μM; Probe 0.1-0.5 μM; 2-8 µL of sample to be tested; Buffer solution 2-3 µL.
10. The detection method according to claim 7, characterized in that, The amplification program for the quantitative real-time PCR is as follows: pre-denaturation at 48-52℃ for 1-3 min; pre-denaturation at 94-96℃ for 1-3 min; denaturation at 94-96℃ for 12-18 s, annealing at 50-60℃ for 28-32 s, extension at 70-74℃ for 28-32 s, for 35-45 cycles, with fluorescence data collected at 70-74℃.