KASP molecular marker primer set and application thereof
By developing a KASP molecular marker primer set for upland cotton, combined with QTL mapping and BSA-seq technology, accurate genotyping of the first fruiting branch node was achieved, solving the problem of simultaneous improvement of precocity and plant type, and improving the efficiency of cotton breeding and the accuracy of variety selection.
Patent Information
- Application Number
- CN202210692779.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-17
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2042-06-17
AI Technical Summary
Existing technologies make it difficult to simultaneously improve the early maturity and machine-harvesting plant type of upland cotton at the molecular level, and existing research results are difficult to accurately identify the first fruiting branch node, affecting the efficiency of cotton breeding and variety selection.
A KASP molecular marker primer set, including forward and reverse primers, was developed for genotyping of the first fruiting branch node of upland cotton. Combining QTL mapping and BSA-seq technology, KASP primers targeting 6 SNPs were designed, and accurate genotyping was achieved through PCR amplification and fluorescence ratio analysis.
It enables accurate identification of the first fruiting branch node of upland cotton, allowing for early prediction of the material's precocity and plant type. This provides more marker resources for the breeding of new cotton varieties suitable for machine harvesting and improves breeding efficiency.
Smart Images

Figure CN115125323B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of crop cultivation, and particularly relates to a KASP molecular marker primer group for identifying the genotyping of the first fruiting branch node of Gossypium hirsutum and application thereof. BACKGROUND
[0002] Gossypium hirsutum is the cotton species with the largest sowing area and the highest yield in the world, accounting for more than 90% of the annual cotton yield, and has made important contributions to the development of the textile industry and the economic income of farmers. In recent years, due to the continuous reduction of cotton planting labor, full mechanization and simplified cultivation have become the main technology of cotton production, and early maturity and machine-harvesting plant type have become important research contents of cotton breeding. The simultaneous improvement of the two will be conducive to the efficient breeding of machine-harvesting varieties. The first fruiting branch node (NFFB) is an important plant type trait of cotton, and its height is an important reference index for mechanical harvesting, and the two are in a very significant positive correlation. According to research, the height of the first fruiting branch node should not be less than 18 cm, which is an important standard for machine-harvesting varieties. At the same time, the first fruiting branch node is an important indicator of early maturity, and is in a very significant positive correlation with flowering period, boll opening period and other traits, and is the most reliable index for identifying early maturity. Compared with flowering period, boll opening period and other early maturity traits, the first fruiting branch node is not affected by diseases and insect pests leading to fallen bolls and other factors; compared with plant height, first fruiting branch node height and other plant type traits, the first fruiting branch node can be identified early, saving time, and is less affected by chemical control. Therefore, the first fruiting branch node has high accuracy, and the reliability of early maturity and plant type identification through the first fruiting branch node is strong.
[0003] Therefore, the first fruiting branch node is a key trait for realizing the simultaneous improvement of early maturity and machine-harvesting plant type of cotton. However, for a long time, yield and fiber quality have been the dominant traits of cotton breeding and production, and researchers have less basic research on early maturity and plant type of cotton. The existing research results are difficult to realize the simultaneous improvement of the two from the molecular level, and in addition, the two have a complex interaction with yield and fiber quality, so the breeding of machine-harvesting varieties has always been at a low level. Therefore, it is urgent to develop effective genes and molecular markers related to the first fruiting branch node of Gossypium hirsutum. SUMMARY
[0004] In view of the above problems, one of the purposes of the present application is to provide a KASP molecular marker primer group for identifying and genotyping the first fruiting branch node related gene of Gossypium hirsutum. The primer group can accurately genotype the first fruiting branch node of Gossypium hirsutum, and has good genotyping effect.
[0005] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0006] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0007] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0008] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0009] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0010] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0011] The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3. BRIEF DESCRIPTION OF DRAWINGS
[0012] Figure 1 The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0013] Figure 2 The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0014] Figure 3 The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0015] Figure 4 The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3.
[0016] Figure 5 The KASP molecular marker primer set provided by the application comprises a forward primer and a reverse primer, wherein the forward primer comprises a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2; and the reverse primer comprises a sequence as shown in SEQ ID NO: 3. DETAILED DESCRIPTION
[0017] The examples are used to better illustrate the present application, but are not intended to limit the present application to only the examples. Therefore, the skilled in the art can make non-essential improvements and adjustments to the embodiments according to the above description, which still belong to the protection scope of the present application.
[0018] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present disclosure. Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, " / '' can be interpreted as "and / or," depending on the context.
[0019] In one aspect, the present application provides a KASP molecular marker primer set for identifying and typing a first fruit branch node related gene of Gossypium hirsutum, wherein the forward primer comprises a sequence identical to SEQ ID NO: 1 at least 90% and a sequence identical to SEQ ID NO: 2 at least 90%; the reverse primer comprises a sequence identical to SEQ ID NO: 3 at least 90%.
[0020] Specifically, in the present application, the key gene regulating the first fruit branch node is located by QTL positioning method, and 6 SNPs are obtained. KASP primers are designed according to 100 bp base sequences of the upstream and downstream of the 6 SNPs extracted from the reference genome. Finally, it is verified that the above KASP molecular marker primer set has good typing effect.
[0021] It should be noted that the first fruiting branch node is a typical quantitative trait, and QTL (Quantitative Traitloci) mapping is an important method for identifying its regulatory genes. By constructing segregating populations and high-density genetic maps, candidate chromosomal locations regulating the first fruiting branch node within the tested population can be located. Based on this, candidate genes can be further finely mapped and functional markers developed. Bulk-segregant analysis sequencing (BSA-seq) is an efficient method for rapid gene mapping of a single trait. By constructing a large segregating population of the target trait, selecting individual plants with extreme traits to construct a pool, and using resequencing technology to obtain differentially expressed genomic locations between pools, the target chromosomal region can be obtained using certain statistical standards. Currently, there are no reported studies combining QTL mapping with BSA-seq for gene mapping and molecular marker development at the first fruiting branch node of upland cotton. SNPs (Single nucleotide polymorphisms) are the most numerous, widely distributed, and polymorphic molecules in the genome, making them ideal molecular markers for constructing high-density genetic maps. High-throughput sequencing technology is the main method for developing high-quality SNPs, and with the reduction in sequencing costs, SNPs are gradually becoming a new generation of widely used molecular markers.
[0022] In another aspect, the present invention provides a detection reagent, which may include the aforementioned KASP molecular marker primer set. Specifically, based on the aforementioned KASP molecular marker primer set, a detection reagent can be formulated for the identification and typing of genes related to the first fruiting branch nodes of upland cotton.
[0023] Furthermore, SEQ ID NO: 1 and SEQ ID NO: 2 may each contain different fluorescent adapters as markers. The fluorescent adapters are fluorescent adapters known to those skilled in the art, such as FAM and HEX. The FAM and HEX sequences are known to those skilled in the art, such as the FAM sequence GAAGGTGACCAAGTTCATGCT and the HEX sequence GAAGGTCGGAGTCAACGGATT.
[0024] Furthermore, the above-mentioned detection reagent may also include a reaction system for gradient PCR amplification. In some exemplary embodiments, the reaction system may include: HiGeno 2x Prob Mix B, a primer set, and a DNA template, wherein each component can be adjusted according to specific circumstances. It should be noted that HiGeno 2x Prob Mix B includes the conditions required for enzymes, bases, and other buffers, and can be replaced by other reagents with the same function known in the art; the concentration ratio of primers SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3 in the primer set can be 2:2:5.
[0025] In another aspect of the present application, a detection kit is provided, which can comprise the KASP molecular marker primer set described above or the detection reagent described above. Specifically, the composition of the detection kit is in a conventional form known in the art, for example, the detection kit can be provided with a kit instruction, for example, reagent bottles containing various detection reagents, for example, a plurality of small cells for placing the detection reagent bottles, for example, a dropper for transferring the detection reagent, etc.
[0026] In another aspect of the present application, the KASP molecular marker primer set described above is provided for use in identifying the first fruit branch node of Gossypium hirsutum. Specifically, the KASP molecular marker primer set described above can accurately identify and genotype the first fruit branch node of Gossypium hirsutum.
[0027] In another aspect of the present application, the KASP molecular marker primer set described above is provided for use in breeding Gossypium hirsutum. Specifically, the KASP molecular marker primer set described above can accurately identify the first fruit branch node of Gossypium hirsutum, can predict the early maturity and plant type of the material early, and can provide more marker resources for accelerating the breeding efficiency of new cotton varieties suitable for machine picking.
[0028] In another aspect of the present application, a method for genotyping the first fruit branch node of Gossypium hirsutum is provided, which can comprise: using the KASP molecular marker primer set described above or the detection reagent described above to perform PCR amplification on the genomic DNA of Gossypium hirsutum.
[0029] Further, the PCR amplification procedure can comprise: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃-55℃ gradient annealing, decreasing by 0.6℃ per cycle for a total of 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for a total of 34 cycles.
[0030] Further, if the detection reagent comprising different fluorescent linkers described above is used for PCR amplification, after the PCR amplification is completed, the genotyping of cotton can be identified according to the difference in the fluorescence value ratio of the PCR amplification product.
[0031] Further, SEQ ID NO: 1 and SEQ ID NO: 2 can be connected to FAM and HEX, respectively, the FAM and HEX fluorescence ratio of the heterozygous cotton genomic DNA is 0.8-1.2, and the FAM and HEX fluorescence ratio of the homozygous cotton genomic DNA is greater than 2 or less than 0.5.
[0032] In order to better understand the present application, the content of the present application will be further illustrated below in combination with specific examples, but the content of the present application is not limited to the following examples only.
[0033] (1) QTL mapping
[0034] A F2 population containing 417 individuals was constructed using Jifeng 914 as the female parent and Jifeng 817 as the male parent, and the first fruiting branch node (NFFB) of the population was investigated. 200 individuals were randomly selected for GBS reduced genome sequencing, and a high-density genetic map was constructed. A NFFB QTL NFFB-D10-1 was located on chromosome D10 with a LOD value of 3.51 and a contribution rate of 6.71%( Figure 1 );
[0035] A strain 2019-1988 with similar plant type and lower first fruiting branch node than Jifeng 914 was selected from the F4 population obtained by continuous selfing of the above F2 population as the female parent, and Jifeng 914 was used as the male parent for backcrossing. A total of 316 BC1F2 individuals were obtained by selfing of BC1F1. 30 individuals with extreme NFFB (5 nodes and 9 nodes) were selected, and the DNA was mixed in equal amounts to construct a pool. SNP was developed using resequencing technology, and gene mapping was performed by ΔSNP-Index and ED algorithms. The intersection of the two algorithms was used as the candidate segment, and two loci were located on chromosome D10 near the upstream of qNFFB-D10-1( Figure 1 )。
[0036] The above results show that there is a key gene regulating NFFB in the 66.5Mb-67.8Mb segment of chromosome D10, which has application value for developing effective molecular markers in this segment. There are 6 SNPs in this segment (Table 1).
[0037] Table 1 Number of SNPs and base positions of target positions
[0038]
[0039]
[0040] (2) Gradient PCR
[0041] For the above 6 SNPs, KASP primers were designed by extracting 100bp upstream and downstream sequences from the reference genome. The DNA of BC1F2 individuals was extracted and diluted to 50ng / uL, and HiGeno 2x ProbMix B of Beijing Ji Cheng Biological Technology Co., Ltd. was used for gradient PCR (Table 2). The PCR system is shown in Table 3 (5uL system). The FAM and HEX fluorescence values of the samples were measured using a multifunctional enzyme marker (BIOTEK, SynergyMX), and ROX was used for error correction. The wavelength is: 480-520, 520-560, 580-620.
[0042] Table 2 Gradient PCR steps
[0043]
[0044] Table 3 Gradient PCR system
[0045]
[0046] (3) Application of KASP marker
[0047] Firstly, 38 single plants and 2 parents were randomly selected from the BC1F2 population, and the KASP primer was pre-screened by the above gradient PCR. It was found that the KASP primer (KASP032) of SNP5 had better typing effect ( Figure 2 );
[0048] Secondly, 361 BC1F2 single plants were genotyped by KASP032 using the above gradient PCR method. It was found that the primer had strong fluorescence value in 356 BC1F2 single plants, and the test materials could be divided into obvious three groups ( Figure 3 ), the FAM and HEX fluorescence value ratio of heterozygous materials was close to 1, and the FAM and HEX fluorescence value ratio of homozygous materials was more than 2 times (more than 2 or less than 0.5) Figure 4 ), which proved that KASP032 had better genotyping effect;
[0049] Finally, in order to clarify the identification effect of KASP on the first fruit branch node, variance analysis was carried out on the first fruit branch node of the material after grouping by the primer. The results showed that the homozygous material with the same genotype (TT) as Jifeng 914 had higher first fruit branch node, and the homozygous material with the same genotype (CC) as Jifeng 817 had lower first fruit branch node, both of which reached extremely significant difference, and the first fruit branch node of the heterozygous (TC) material was between the homozygous materials, and reached extremely significant difference level with the homozygous materials Figure 5 )。
[0050] In summary, KASP032 is an effective molecular marker for identifying the first fruit branch node of upland cotton. By using the above gradient PCR method, the first fruit branch node can be accurately identified by using the marker, which is helpful to early prediction of the early maturity and plant type of the material, and provides more marker resources for accelerating the breeding efficiency of new cotton varieties suitable for machine picking.
[0051] Finally, it should be pointed out that the above examples are only used to illustrate the technical solutions of the present application and not to limit it. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the purpose and scope of the present application, and they should be covered in the scope of the claims of the present application. SEQUENCE LISTING <110> Hebei Academy of Agriculture and Forestry Sciences <120> KASP molecular marker primer set and application thereof <130> 14-JUN-2022 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 tactgggtta attttctttc tcattctatt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 tactgggtta attttctttc tcattctatc 30 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 ggacgggata tgatggggat att 23
Claims
1. A KASP molecular marker primer set, characterized in that, The forward primer is the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2; the reverse primer is the sequence shown in SEQ ID NO:
3.
2. A detection reagent, characterized in that, Includes the KASP molecular marker primer set as described in claim 1.
3. The detection reagent according to claim 2, characterized in that, SEQ ID NO: 1 and SEQ ID NO: 2 each contain different fluorescent connectors.
4. A test kit, characterized in that, Includes the KASP molecular marker primer set as described in claim 1 or the detection reagent as described in claim 2.
5. The application of the KASP molecular marker primer set as described in claim 1 in the identification of the first fruiting branch node of upland cotton.
6. The application of the KASP molecular marker primer set as described in claim 1 in upland cotton breeding.
7. A method for genotyping the first fruiting branch node of upland cotton, characterized in that, include: The genomic DNA of upland cotton was amplified by PCR using the detection reagents described in claim 3.
8. The method for genotyping the first fruiting branch node of upland cotton according to claim 7, characterized in that, The PCR amplification program includes: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient annealing from 61℃ to 55℃, decreasing by 0.6℃ per cycle, for a total of 10 cycles; 95℃ denaturation for 20 s, annealing at 55℃, for a total of 30-34 cycles.
9. The method for genotyping the first fruiting branch node of upland cotton according to claim 7 or 8, characterized in that, After PCR amplification, the genotyping of upland cotton was identified based on the difference in the fluorescence value ratio of the PCR amplification products.
10. The method for genotyping the first fruiting branch node of upland cotton according to claim 9, characterized in that, SEQ ID NO: 1 and SEQ ID NO: 2 are linked to FAM and HEX, respectively. The fluorescence ratio of FAM to HEX for heterozygous upland cotton genomic DNA is 0.8-1.2, and the fluorescence ratio of FAM to HEX for homozygous upland cotton genomic DNA is greater than 2 or less than 0.5.
Citation Information
Patent Citations
Methods and systems for targeted modification of plant genes via meristem modulation and plants having engineered meristem modifications and other mutations
US20220372503A1