KASP primer group for detecting wheat plant height and yield synergistically-improved QTL locus QPH-6A and application of KASP primer group
By developing the QPH-6A KASP primer set, we were able to reduce wheat plant height, increase thousand-grain weight and spike length without reducing yield. This solved the breeding challenges of traditional dwarfing genes in drought environments and improved the accuracy of breeding selection and yield potential.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-05-08
AI Technical Summary
Existing technologies make it difficult to reduce plant height through breeding without affecting wheat yield, especially under drought or deep sowing conditions. The negative effects of traditional dwarfing genes, such as excessively short plants, premature aging, and reduced biomass, limit their application in specific ecological environments. Furthermore, existing molecular markers lack precision, resulting in low selection efficiency.
We developed a KASP primer set for detecting the QTL locus QPH-6A, which is used to synergistically improve wheat plant height and yield. We screened wheat germplasm carrying the superior QPH-6A allele through precise molecular marker detection, and performed PCR amplification using the specific primer set and distinguished alleles by fluorescence signals, thus achieving efficient screening and breeding.
While reducing plant height, it significantly increases thousand-grain weight and ear length, overcomes the negative effects of traditional dwarfing genes, adapts to drought environments, improves the accuracy of breeding selection and yield potential, and is suitable for rapid screening of large-scale breeding populations.
Smart Images

Figure CN121992134A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant bioengineering technology, and in particular to a KASP primer set for detecting the QTL site QPH-6A, which is used to synergistically improve wheat plant height and yield, and its application. Background Technology
[0002] Wheat (Triticum aestivum L.) is a key crop for global food security. Plant height, as a core agronomic trait determining its plant structure and yield, directly affects the crop's lodging resistance and harvest index. The "Green Revolution" of the mid-20th century significantly reduced plant height and enhanced lodging resistance by introducing gibberellin-insensitive semi-dwarf genes (mainly Rht-B1b on chromosome 4B and Rht-D1b on chromosome 4D). However, with the advancement of breeding practices, the negative effects of these two major genes have become increasingly prominent: they inhibit cell elongation, leading to shortened coleoptiles, which severely affects seedling emergence rate and vigor under drought or deep sowing conditions; especially in arid and semi-arid ecological zones such as Xinjiang in my country, the strong dwarfing effect of Rht-B1b / D1b often results in excessively short plants, premature aging, and a significant reduction in biomass, making it difficult to support the construction of high-yielding populations and limiting its adaptability in specific ecological environments.
[0003] To overcome the shortcomings of traditional Rht genes, the discovery of novel dwarfing genes that are sensitive to gibberellins and have no negative impact on yield has become a breeding hotspot, with chromosome 6A attracting particular attention due to its rich genetic variation. However, breaking the trade-off between dwarfing and yield reduction remains a challenge in wheat breeding. While there are reports on QTLs related to plant height on chromosome 6A (such as QTLs located on the long arm of chromosome 6A), studies have shown that dwarfing alleles at these loci are often accompanied by adverse effects such as reduced thousand-grain weight and shorter spike length. This "inverse" trait correlation makes it difficult for breeders to maintain or increase individual plant productivity while using these genes to reduce plant height, limiting the practical application value of these loci in high-yield breeding.
[0004] Furthermore, studies on plant height loci in regions such as the short arm of chromosome 6A mostly rely on genome-wide association studies (GWAS) to locate target genes within physically wide ranges (e.g., at the Mb level), lacking fine-grained localization of key functional sites (QTNs). Due to the vast and complex wheat genome, regions differing by only a few Mb in physical distance may contain entirely different gene clusters, and linkage disequilibrium decays rapidly. Current technologies lack practical molecular markers capable of precisely anchoring superior allelic variations that are tightly linked to the "dwarfing-yield synergistic effect." In actual breeding, using flanking markers with broad ranges for auxiliary selection is highly susceptible to false positives due to chromosome crossing over, leading to low selection efficiency.
[0005] In conclusion, the current field of wheat molecular breeding urgently needs to discover a new genetic resource that can replace Rht-B1b / D1b, adapt to arid ecological environments, and achieve "moderate dwarfing without yield reduction" or even synergistic yield increase. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide a KASP primer set for detecting the QTL locus QPH-6A for synergistic improvement of wheat plant height and yield and its application. By developing a precise molecular marker detection primer set, wheat germplasm carrying the superior QPH-6A allele can be screened, thereby significantly increasing thousand-grain weight, spike length and number of grains per spike while reducing plant height, and cultivating new high-yielding wheat varieties with ideal plant type suitable for planting in Xinjiang and arid and semi-arid regions.
[0007] The present invention solves the above-mentioned technical problems through the following technical means: In a first aspect, the present invention provides a KASP primer set for detecting the QTL locus QPH-6A for synergistic improvement of wheat plant height and yield, characterized in that the primer set consists of two allele-specific forward primers and one universal reverse primer; the nucleotide sequence of the allele-specific forward primer F1 is shown in SEQ ID NO:1, the nucleotide sequence of the allele-specific forward primer F2 is shown in SEQ ID NO:2, and the nucleotide sequence of the universal reverse primer R is shown in SEQ ID NO:3; the QTL locus QPH-6A is located on wheat chromosome 6A, at position 11164425 bp on the IWGSC RefSeq v1.0 reference genome, and this site exhibits a G / A single nucleotide polymorphism.
[0008] The specific forward primer F1 is 5'-GAAGGTGACCAAGTTCATGCTtctacccagcaaacttccttC-3' (as shown in SEQ ID NO:1), whose 3' end base recognizes the C base on the C / G complementary strand; The specific forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTtctacccagcaaacttccttT-3' (as shown in SEQ ID NO:2) has a 3' end base that recognizes the T base on the A / T complementary strand; Universal reverse primer R: 5'-acacgctcggatgttaatggtA-3' (as shown in SEQ ID NO:3). In this primer, the 5' ends of SEQ ID NO:1 and SEQ ID NO:2 are each linked with a different universal tag sequence for binding fluorescent probes with different fluorescent groups (such as FAM or HEX).
[0009] Secondly, the present invention provides a kit for identifying wheat plant height and yield traits, characterized in that it contains the aforementioned KASP primer set.
[0010] Further preferably, the kit also includes a KASP reaction premix containing fluorescent probes (such as FAM-probes and HEX-probes) targeting the above-mentioned universal tag sequence, DNA polymerase, dNTPs, and reaction buffer.
[0011] Thirdly, the present invention provides an application of the KASP primer set or the kit described herein in molecular marker-assisted breeding of wheat.
[0012] Preferably, the application specifically involves screening or breeding wheat varieties with dwarfing and high-yielding traits.
[0013] Preferably, the dwarfing and high-yielding trait refers to the following: compared with plants that do not carry the superior QPH-6A allele, plants carrying the superior QPH-6A allele exhibit significantly reduced plant height and significantly increased thousand-grain weight, ear length, and / or ear grain number.
[0014] Preferably, the application is for the purpose of breeding wheat varieties suitable for planting in arid and semi-arid regions.
[0015] Further preferably, the application specifically includes: Germplasm resource identification: Genotyping of wheat germplasm resources and screening for materials carrying the superior QPH-6A allele (corresponding to the amplification signal of the forward primer F2); Parental selection and offspring screening: In hybridization or backcross breeding, this marker is used to track target genes and screen for individual plants with the potential for dwarfing and high-yielding phenotypes.
[0016] Fourthly, the present invention provides a method for breeding new wheat varieties with synergistic improvement of plant height and yield traits, characterized by comprising the following steps: (1) extracting genomic DNA from the wheat material to be tested; (2) performing PCR amplification of the DNA to be tested using the primer set described in claim 1; (3) detecting fluorescence signals on the amplification products: if a fluorescence signal corresponding to SEQ ID NO:2 is detected, it is determined that the material to be tested carries the superior QPH-6A allele, and its phenotype potential of dwarfing and high yield is predicted; if a fluorescence signal corresponding to SEQ ID NO:1 is detected, it is determined that the material to be tested carries the non-superior QPH-6A allele; (4) selecting materials carrying the superior QPH-6A allele for seed saving or as parents for hybridization breeding.
[0017] Preferably, the selection criteria for seed saving or backcrossing in step (4) further include: the selected single plant has a plant height range of 75cm-85cm at maturity.
[0018] Fifthly, the present invention provides a method for predicting the yield potential of wheat germplasm resources using the primer set, characterized by comprising: genotyping wheat germplasm resources from different sources using the primer set; classifying germplasm resources carrying the superior QPH-6A allele as high-thousand-grain-weight and high-ear-length potential materials; and classifying germplasm resources carrying the non-superior QPH-6A allele as materials with excessively high plant height or yield potential that needs improvement.
[0019] The beneficial effects of this invention are: (1) The QPH-6A locus locked by this invention has a unique genetic effect. Its superior haplotype (Hap-I) can significantly increase the thousand-grain weight, ear length and ear grain number while reducing the plant height to a suitable range for lodging resistance (75-85cm), thus achieving the technical effect of "dwarfing without reducing yield but increasing yield".
[0020] (2) This invention locates the QTL at a single SNP locus of 11164425 bp on chromosome 6A, with a precision far exceeding that of existing technologies (such as GWAS analysis, which typically locates the QTL in a range of several Mb). The developed KASP marker is designed directly for this functional SNP (or a very closely linked SNP), effectively avoiding recombination and exchange errors that may be caused by using flanking markers, and greatly improving the accuracy of breeding selection.
[0021] (3) In response to drought conditions, the QPH-6A locus overcomes the problems of weak seedling vigor and premature aging caused by the traditional Rht gene. Varieties bred using the marker of this invention can still maintain high biomass accumulation and yield potential under drought stress, and have significant regional adaptability advantages.
[0022] (4) The KASP marker developed in this invention is based on PCR amplification and endpoint fluorescence reading, requiring no enzyme digestion or electrophoresis, making it suitable for high-throughput, automated detection. Compared to SNP chips, its single-sample detection cost is extremely low, making it ideal for rapid screening of large-scale breeding populations. Attached Figure Description
[0023] Figure 1 A represents the SNP genotyping diagram for KASP markers, and B represents the genotyping results of the F2 population used for KASP marker validation.
[0024] Figure 2 The results show the phenotypic yield traits among the various haplotypes of QPH-6A. Among them, the superior haplotype Hap-Ⅰ showed improved tillering rate (TSC), spike length (SPL), number of grains per spike (GNS), thousand-grain weight (KTW), and yield. Detailed Implementation
[0025] The technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. The wheat reference genome version described in this invention is IWGSC RefSeq v1.0.
[0026] Example 1: Fine mapping of wheat plant height QTL QPH-6A and KASP primer design 1. Site discovery and localization Based on genome-wide association analysis (GWAS) of natural wheat populations in Xinjiang, the inventors discovered a major-effect QTL locus on the short arm of wheat chromosome 6A, significantly associated with plant height, thousand-grain weight, and spike length, named QPH-6A. Through fine mapping, this locus was located at physical position 11,164,425 bp on chromosome 6A. Sequence analysis revealed a single nucleotide polymorphism (SNP) at this locus, exhibiting a G / A variation.
[0027] The site sequence is ATGGTATAGAACTGCCAGGTCTTTGAGAAGAATTCGCATATTCAGGCGCA[G / A]AAGGAAGTTTGCTGGGTAGAGTCGAATCTTGTGCCAAACCATCTGATGA.
[0028] 2. Primer design For the aforementioned SNP sites, a KASP genotyping primer set was designed using the PolyMarker online tool. This primer set contains two allele-specific forward primers (F1, F2) and one universal reverse primer (R). To distinguish fluorescence signals, a universal tag sequence (Tag1) corresponding to HEX fluorescence was added to the 5' end of forward primer F1, and a universal tag sequence (Tag2) corresponding to FAM fluorescence was added to the 5' end of forward primer F2. The specific sequences are as follows: Specific forward primer F1 (recognizes G bases): 5'-GAAGGTGACCAAGTTCATGCTtctacccagcaaacttccttC-3'(SEQ ID NO:1) (Note: The lowercase part is the specific sequence, the uppercase part is the HEX tag, and the C at the end specifically identifies the G / C complementary pair) Specific forward primer F2 (recognizes A base): 5'-GAAGGTCGGAGTCAACGGATTtctacccagcaaacttccttT-3'(SEQ ID NO:2) (Note: The lowercase part is the specific sequence, the uppercase part is the FAM tag, and the T at the end specifically identifies the A / T complementary pair) Universal reverse primer R: Sequence: 5'-acacgctcggatgttaatggtA-3' (SEQ ID NO:3).
[0029] Example 2: KASP genotyping method for QPH-6A locus This embodiment provides a standard procedure for genotyping using the primer set described in Example 1.
[0030] 1. DNA extraction Genomic DNA was extracted from wheat leaves using the CTAB method and diluted to approximately 50 ng / μL.
[0031] 2. PCR reaction Primers were diluted to a concentration of 100 μmol. The PCR detection system consisted of 0.44 μL of primers A and B, 1.32 μL of primer Common, 70 μL of 2×Mix, and 1 μL of DNA template. A water bath PCR instrument was used with the following program: Step 1: 94℃ for 15 min; Step 2: 65℃~57℃ (-0.8℃ / cycle) for 60 s for 10 cycles; Step 3: 94℃ for 20 s, 57℃ for 60 s for 38 cycles.
[0032] 3. Result Interpretation Hap-I type (superior allele): A single FAM fluorescence signal was detected (corresponding to an A / A homozygous SNP site), and the genotype was determined to be this type.
[0033] Hap-II type (non-superior allele): A single HEX fluorescence signal was detected (corresponding to a G / G homozygous SNP site), and the genotype was determined to be this type.
[0034] Heterozygous: Both FAM and HEX fluorescence signals were detected simultaneously, indicating a heterozygous (G / A) type.
[0035] Example 3: Application of wheat QPH-6A molecular marker 1. Material collection and field trials: We collected 455 wheat varieties from around the world and screened them over three years in Changji and Beitun, Xinjiang, identifying 287 stable materials (including 67 local varieties, 41 breeding materials, and 132 modern varieties). Field trials were conducted in four different environments: Changji and Beitun in Xinjiang, Chengdu in Sichuan, and Yangling in Shaanxi, where plant height (the distance from the ground to the tip of the ear during the late grain-filling stage) was measured.
[0036] 2. Genome analysis: GWAS analysis was performed using 157,050 high-quality SNP loci, with a mixed linear model (MLM) controlling for population structure and phylogenetic relationships. Multilocus model analysis was conducted through 100 resampling cycles (randomly selecting 80% of varieties each time) to screen for significant associations in at least two environments (P < 1.0 × 10⁻⁶). -4 SNPs that are selected in at least 10 resampling iterations.
[0037] 3. KASP tag development and verification: Based on SNP information, 16 KASP tags were developed using the PolyMarker website.
[0038] The genetic effects of QTLs, including QPH-6A, were validated using an F2 segregating population (2 combinations, 500 offspring in total).
[0039] 4. Experimental Results (1) QTL identification: GWAS analysis revealed a unique selection pattern for QPH-6A in the Xinjiang region.
[0040] (2) Region selection mode: Wheat breeders in Xinjiang have developed a unique selection strategy that avoids the use of Rht-B1b and Rht-D1b, and strongly favors the QPH-6A dwarf haplotype (Hap-I).
[0041] Modern varieties from Xinjiang have a narrow range of plant height (60-85cm), while varieties from other regions have a wider range of plant height.
[0042] (3) KASP tag verification: The KASP marker developed for QPH-6A was successfully applied to two F2 segregating populations.
[0043] The verification results showed that the dwarfing effect of QPH-2A and QPH-6B was recessive, while the dwarfing effect of QPH-6A was dominant.
[0044] (4) Environmental interaction analysis: QPH-6A Hap-I exhibited stable medium plant height (75-85cm) in Xinjiang, while significantly increasing thousand-grain weight, ear length, and number of grains per ear.
[0045] In contrast, Rht-B1b and Rht-D1b resulted in excessively short plants (40.8-64.6 cm) in Xinjiang, accompanied by a significant decrease in yield traits.
[0046] 5. Conclusion This study identified four stable plant height QTLs in wheat germplasm resources in Xinjiang, among which QPH-6A is a selection site unique to Xinjiang.
[0047] Xinjiang wheat breeders have developed a unique selection strategy that avoids the use of traditional Green Revolution genes and instead favors the QPH-6A dwarf haplotype. This allows Xinjiang wheat to achieve optimal plant height (75-85cm) under arid conditions, accompanied by better yield traits.
[0048] The developed KASP molecular marker can effectively distinguish different plant height haplotypes, providing a specific molecular tool for wheat breeding in Xinjiang.
[0049] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.
Claims
1. A KASP primer set for detecting the QTL site QPH-6A, which is used to synergistically improve wheat plant height and yield, characterized in that, The primer set consists of two allele-specific forward primers and one universal reverse primer; the nucleotide sequence of the allele-specific forward primer F1 is shown in SEQ ID NO:1, the nucleotide sequence of the allele-specific forward primer F2 is shown in SEQ ID NO:2, and the nucleotide sequence of the universal reverse primer R is shown in SEQ ID NO:3; the QTL site QPH-6A is located on wheat chromosome 6A, at position 11164425 bp on the IWGSC RefSeq v1.0 reference genome, and this site exhibits a G / A single nucleotide polymorphism.
2. A kit for identifying wheat plant height and yield traits, characterized in that, It includes the KASP primer set as described in claim 1.
3. The application of the KASP primer set of claim 1 or the kit of claim 2 in molecular marker-assisted breeding of wheat.
4. The application according to claim 3, characterized in that, The specific application is to screen or breed wheat varieties with dwarf and high-yield traits.
5. The application according to claim 4, characterized in that, The dwarfing and high-yielding trait refers to the following: compared with plants that do not carry the superior QPH-6A allele, plants carrying the superior QPH-6A allele exhibit significantly reduced plant height and significantly increased thousand-grain weight, ear length, and / or ear grain number.
6. The application according to claim 3, characterized in that, The application is for the purpose of breeding wheat varieties suitable for planting in arid and semi-arid regions.
7. A method for breeding new wheat varieties with synergistic improvement in plant height and yield traits, characterized in that, Includes the following steps: (1) Extract genomic DNA from the wheat material to be tested; (2) PCR amplification of the DNA to be tested using the primer set described in claim 1; (3) Detection of fluorescence signal on the amplification product: if a fluorescence signal corresponding to SEQ ID NO:2 is detected, it is determined that the material to be tested carries the superior allele of QPH-6A and predicts that it has the phenotype potential of dwarfism and high yield; if a fluorescence signal corresponding to SEQ ID NO:1 is detected, it is determined that the material to be tested carries the non-superior allele of QPH-6A; (4) Select materials carrying the superior allele of QPH-6A for seed saving or use as parents for hybridization breeding.
8. The method according to claim 7, characterized in that, The selection criteria for seed saving or backcrossing mentioned in step (4) also include: the selected individual plants have a height range of 75cm-85cm at maturity.
9. A method for predicting the yield potential of wheat germplasm resources using the primer set described in claim 1, characterized in that, include: Genotyping of wheat germplasm resources from different sources was performed using the primer set described above; Germplasm resources carrying the superior QPH-6A allele were classified as materials with high thousand-grain weight and high ear length potential; germplasm resources carrying the non-superior QPH-6A allele were classified as materials with excessively high plant height or yield potential that need improvement.