33 results about "Adductor muscles" patented technology

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.

The invention discloses a nucleus insertion method in seawater pearl culture nucleus insertion and pearl culture operation. The method is characterized by comprising the steps that before an operation, all operation instruments are strictly disinfected, mother pearl shellfish is thoroughly cleaned, mouth plugging is carried out at first, a mouth opener is used for opening the two shells of mother pearl shellfish, then a wedge is plugged in to facilitate nucleus insertion, the pallium is cut and obtained, a scalpel is inserted into the rear ventral edge of saibo donors at first to cut off adductor muscle and divide the shellfish body into two parts, then shellfish gill is pushed aside, the pallium or an inner cushion thereof are cut off from the tail end of the gill below the chilidium, small cell pieces are manufactured, color line alignment is carried out, the pallium is finished, and finally nucleus insertion is carried out. The defects that culture benefits are low and the labor intensity is large in traditional, simple and rough nucleus insertion operation are overcome, seawater pearl culture is more scientific, and culture economic benefits are more remarkable.

The invention relates to a manufacturing method of a scallop color fan for measuring the total carotenoid content in adductor muscles of scallops and application of the scallop color fan. The content range of the total carotenoid in the adductor muscles of each scallop can be obtained within 3-5 seconds by comparing the manufactured scallop color fan with the adductor muscle color of the scallop. The content range of the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is 10-250 Mu g/g. The manufacturing method of the scallop color fan for measuring the total carotenoid content in adductor muscles of scallops is simple and strong in operability. A method for measuring the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is rapid, simple, convenient, high in efficiency, low in cost, easy to popularize, strong in practicability and strong in environmentally-friendly property.

The invention discloses a water-jet scallop adductor muscle separating device. The device is composed of a clamping fixture (1), an angle adjusting mechanism (2), a separating nozzle (3), a washing nozzle (4), a transmission belt (5), and a support (6). The device is simple to operate, and the adductor muscle on scallop can be separated rapidly. The provided device can achieve automatic processing of scallop, improves the work environment, reduces the labor strength, and improves the work efficiency. Furthermore, the internal organs of scallop can be collected by the device, the post processing becomes more convenient, and the profits are increased.

The invention relates to a joint motion estimation method based on a myoelectricity and myotone model and unscented particle filtering. The method comprises the following steps: firstly, acquiring surface myoelectricity and muscle sound signals of biceps brachii muscle, triceps brachii muscle, radial brachii muscle, trapezius muscle, adductor muscle, anterior deltoid muscle, lateral deltoid muscleand pectoralis major muscle of an upper limb shoulder joint and an elbow joint of a human body in a synchronous continuous motion state, and respectively performing band-pass filtering processing; then, extracting Wilson amplitude and fuzzy entropy features of the surface myoelectricity and myotone signals; combining the physiological muscle model and joint kinematics through parameter substitution and simplification to form a joint motion model, and forming a measurement equation by using the extracted features to serve as feedback of the joint motion model to obtain a myoelectricity myotonestate space model; and finally, estimating the synchronous continuous motion of the shoulder joint and the elbow joint through an unscented particle filter algorithm. Compared with a traditional multi-joint synchronous continuous motion estimation method, the method has the advantage that the prediction precision and the real-time performance are obviously improved.

The invention discloses a method for rapidly detecting a content of scallop adductor muscle glycogen on site, which can realize determination of a glycogen content of adductor muscle food of scallopsthrough simple operations such as glycogen extraction by an alkali liquor, iodine solution color development, colorimetric card comparison and the like on site (culture sea areas, coasts, food processing workshops and other non-laboratory occasions). According to the method, a sample does not need to be transported to a laboratory, precise instruments such as a microplate reader, a spectrophotometer and the like do not need to be used, operation is easy and convenient, rapid detection of the adductor muscle glycogen content can be achieved, and a detection result is accurate.

The invention discloses a method for cultivating miniature seawater natural pearls through stimulation of calcium carbonate powder. The method comprises the following steps that firstly, the calcium carbonate powder and a dry powder injection machine are prepared; mature pearl shells are selected and opened; the calcium carbonate powder is correspondingly sprayed to adductor muscle parts, pallium surfaces and digestive blastocyst parts of the pearl shells once, and the calcium carbonate powder is dissolved and absorbed through pearl mother liquor; then the treated pearl shells are put into a seawater pond for recuperation; after recuperating, the pearl shells are put into seawater to be cultured for 3 months, the pearl shells are fished out, dead pearl shells are removed, attachments are cleaned, and pearl shells with generated pearl sacs are distinguished and screened out through an X-ray machine; and finally, the pearl shells with the generated pearl bags are put into seawater to be bred in a hanging mode for 10-12 months, and the cultivating process is completed. According to the method for cultivating the miniature seawater natural pearls through stimulation of the calcium carbonate powder, the process that foreign matter such as sand enters the shell bodies to generate pearls is simulated, the pearl shells form pearl bags and secrete nacre through stimulation of the calcium carbonate powder reserved in the shell bodies, and finally the seawater pearls with high nacre purity are obtained through cultivation and can serve as raw material components of medicines or cosmetics.

The invention provides a method for measuring the adductor muscle tension of a bivalve. The method comprises the following steps of firstly, placing a scallop to be measured into an inflated circulating seawater system for ten minutes or above; debugging equipment and software, connecting a serial port, and performing an online test through data analysis software to determine that the equipment is successfully connected with the software; then, carrying out scallop tension detection, and after an upper clamping piece and a lower clamping piece are stably clamped by double shells of the scallop, starting measurement, wherein measurement time is 3 minutes; and finally, carrying out tension parameter analysis, exporting data to an excel table after measurement is finished, and carrying out calculation of four scallop tension indexes. By improvement of existing scallop tension measuring system equipment and establishment of a scallop tension index standardized measuring method, low-cost, high-efficiency and standardized measurement of scallop adductor muscle tension is realized, and a reliable technical means is provided for subsequent scallop breeding.

The invention discloses a device and method for improving the fishing quality of mudflat shellfish products, which can enable shellfish to contract adductor muscles in advance to close shells before harvesting, and prevent the situations that the adductor muscles are not contracted in time due to sudden impact of high-pressure water flow in the shellfish harvesting process, the shells are not closed, mud and sand are poured into shellfish bodies, a strong stress reaction is caused, and the survival rate and the eating taste of the shellfish are directly influenced. Meanwhile, in the shellfish harvesting process, the device can collect a bottom mud sample of a mudflat shellfish culture area, and pressure data and vibration frequency data generated by rolling of the device are continuously collected through a pressure sensor and a vibration sensor. By applying the shellfish catching device, the stress reaction of shellfish can be reduced, and the quality of collected shellfish products is guaranteed. According to the substrate condition of the shellfish culture area, the variety and specification of shellfish suitable for bottom sowing in the sea area are selected. Catching strategies for different shellfish varieties and specifications are determined, and the shellfish catching quality and efficiency are improved.

The invention relates to the field of marine animal and plant extraction, and concretely relates to an unfolding positioning type shell treatment device. The technical problem to be solved by the invention is to provide the unfolding positioning type shell treatment device. The unfolding positioning type shell treatment device comprises a first collecting frame plate, a turning and throwing separation mechanism, a position correcting mechanism, a shell and meat separation mechanism, a material conveying belt, a collecting basket, an electric rotating plate and the like. The upper part of a fixed support leg underframe is connected with a working machine tool plate. Subsequent treatment of shells in the seafood market is achieved, small-size shells which are not subjected to fleshing in fleshed shells are rapidly turned and separated, disordered shells are placed in order, all the fleshed shells are kept in the state that openings face upwards, then the shells with the openings facing upwards are opened and positioned, the shells with the openings facing upwards are placed in orderm adductor muscle muscles in the shells are rapidly separated, and the effect that the shells without meat residues are obtained is achieved.

The invention discloses a low-damage shellfish blood drawing method. The method comprises the steps: selecting healthy individuals with sound appearance; weighing the selected individuals, and computing safe drawn blood volume; forming a micropore above a thick musculus adductor of one individual by a jewelry cutter; inserting the thick musculus adductor of Cyclina sinensis with a disposable sterile syringe by 0.5cm-1cm to draw blood, and controlling the drawn blood volume; placing the blood-drawn individual back into clean seawater for culture, and adding antibiotics into the water; and determining next blood drawing time according to recovery conditions of the Cyclina sinensis and experiment needs. According to the method, the problem of the traditional culture breeding that experiment data are lost due to death of parents is solved, blood can be drawn from the parents to extract required data when the parents still survive, and subsequent growth of the parents cannot be affected. Compared with the traditional lethal sampling method, the low-damage shellfish blood drawing method has the advantages that great damage to experimental animals is avoided, and the method has an important research significance and practical value in the aspects of endangered animal resource conservation, full-gene selective breeding of economic species, and the like.

The invention discloses a method for timely judging the low-temperature injury degree of chlamys nobilis. According to the invention, a timely chlamys nobilis low-temperature injury judgment standard is established, the digestive gland and adductor muscle of the chlamys nobilis are respectively subjected to fat and glycogen content detection, and the injury degree judgment standard is compared, specifically, low-temperature first-degree injury refers that the fat content of digestive glands is less than or equal to 40% and the glycogen content of adductor muscles is less than or equal to 15mg/g; low-temperature second-degree injury refers that the fat content of digestive glands is less than or equal to 45% and the glycogen content of adductor muscles is less than or equal to 20mg/g, and is higher than the first-degree injury standard; and low-temperature non-injury refers that the fat content of digestive glands is greater than 45% or the glycogen content of adductor muscles is greater than 20mg/g. According to the method, whether the chlamys nobilis is in the low-temperature injury state or not and the degree of the low-temperature injury state can be judged by detecting the fat content and the glycogen content, the degree of the low-temperature injury to parent scallops required by breeding can be judged in time, and support is provided for breeding of low-temperature-resistant varieties.

The invention provides a method for quickly evaluating the resistance of bivalve mollusks based on a tension index, which is a method for detecting the tension index without damage on the basis of not influencing the activity of a tested individual and quickly evaluating the resistance of scallops based on the tension index. According to the method, efficient and lossless tension detection is carried out on the scallops, and the obtained four tension indexes including the total force, the shell closing time, the average force and the maximum force of the scallops serve as the basis for rapidly evaluating the scallop resistance. Compared with the traditional method, the method provided by the invention can realize nondestructive living body detection, and compared with a concentricity detection method, the method provided by the invention has the characteristics of being more stable, accurate, simple, convenient, high in detection success rate and the like. In addition, the tension of the adductor muscle of the scallop is used as an index for rapidly evaluating the resistance of the scallop for the first time. The method provided by the invention can provide reference for scallop resistance index determination, and provides technical support for subsequent breeding of scallop stress-resistant varieties.