35 results about "Adductor muscles" patented technology

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.

The invention provides a human body body hip modeling and simulation method based on muscle groups, and relates to the human body hip modeling and simulation method based on the muscle groups. The object of the method is to solve the problem that existing human hip models cannot take into account refined human body structures and finite element simulation implementing, and the human body hip modeling and simulation method based on the muscle groups is provided. The method comprises the steps of first, acquiring human hip image data; second, conducting geometric modeling on human hip, which includes geometric three-dimensional reconstruction of hip bone (cortical bone and cancellous bone), thigh bone (cortical bone and cancellous bone), articular cartilage, sartorius muscle, musculi quadriceps femoris, biceps femoris, semitendinosus, semimembranosus, gracilis, phalanges, long adductors, short adductors, adductor muscles, gluteus maximus, gluteus medius, gluteus maximus and entire hip; third, establishing muscle group models, conducting model assembly on the hip bone, the thigh bone, the articular cartilage, the muscle groups and the whole hip, establishing a fat and skin model, andadding tendon; fourth, determining meshing parameters, determining inter-tissue contact relationship, and implementing the meshing of the geometric models; fifth, attaching materials to the structureof each part of the human hip model, and determining the material parameters; sixth, achieving mechanical simulation of the human hip model. The method is used in the field of biomedical engineering.

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.

The present invention discloses an improved measuring device for tension of adductor muscles of bivalve shellfish. The improved measuring device comprises a base seat and two guide rods arranged in parallel at an upper side end of the base seat, upper ends of the guide rods are erected with a connecting plate, the guide rods are sleeved with a lifting block in a sliding way, transmission screw holes are arranged in an upper end surface and a lower end surface of the lifting block, and the transmission screw holes are provided with a lifting screw rod in a matching manner. The improved measuring device is designed aiming at disadvantages of the existing devices, can directly display measured data, realizes power output by using thread transmission, so that power input is more steady, in addition, an embedded design of two upper and lower tension plates greatly reduces thickness of the tension plates during insertion, damages to the shells during the insertion is avoided, stress surfacesof the two tension plates are both provided with elastic layers which help avoiding local stress of the shells to cause shell local rupture, and practicality is strong.

The invention discloses a nucleus insertion method in seawater pearl culture nucleus insertion and pearl culture operation. The method is characterized by comprising the steps that before an operation, all operation instruments are strictly disinfected, mother pearl shellfish is thoroughly cleaned, mouth plugging is carried out at first, a mouth opener is used for opening the two shells of mother pearl shellfish, then a wedge is plugged in to facilitate nucleus insertion, the pallium is cut and obtained, a scalpel is inserted into the rear ventral edge of saibo donors at first to cut off adductor muscle and divide the shellfish body into two parts, then shellfish gill is pushed aside, the pallium or an inner cushion thereof are cut off from the tail end of the gill below the chilidium, small cell pieces are manufactured, color line alignment is carried out, the pallium is finished, and finally nucleus insertion is carried out. The defects that culture benefits are low and the labor intensity is large in traditional, simple and rough nucleus insertion operation are overcome, seawater pearl culture is more scientific, and culture economic benefits are more remarkable.

The invention discloses a breeding method for scallop hybridization breeding. The breeding method is characterized by comprising the steps that firstly, gonad development synchronous breeding is carried out on selected chlamys farreri and Argopecten irradians; then, fully-developed female chlamys farreri in the chlamys farreri and the fully-developed Argopecten irradians are selected, after the female chlamys farreri finishes spawning, the hermaphroditic Argopectehs irradians is set for spermiation, and fertilization is carried out on sperms and eggs to form scallop hybridization fertilized eggs; incubation is carried out on the hybridization fertilized eggs, then larva selection is carried out, and larvas are bred in a larva breeding pond; finally the bred larvas are bred to scallop hybridization fry capable of being bred through settlement and metamorphosis. The hybridization scallop fry are bred from the female chlamys farreri and the Argopectehs irradias in a hybridization mode, and have the prominent advantages that in the breeding process, growing speed is high, resistance to diseases is high, the gonad is poor in fertility, the adductor muscle is large, the growing speed can be improved by more than 30 percent, the yield of primary products of the adductor muscle is improved by more than 40 percent, the obvious heterosis is achieved, and the sustainable development of scallop culture in China can be promoted.

The invention relates to a manufacturing method of a scallop color fan for measuring the total carotenoid content in adductor muscles of scallops and application of the scallop color fan. The content range of the total carotenoid in the adductor muscles of each scallop can be obtained within 3-5 seconds by comparing the manufactured scallop color fan with the adductor muscle color of the scallop. The content range of the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is 10-250 Mu g / g. The manufacturing method of the scallop color fan for measuring the total carotenoid content in adductor muscles of scallops is simple and strong in operability. A method for measuring the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is rapid, simple, convenient, high in efficiency, low in cost, easy to popularize, strong in practicability and strong in environmentally-friendly property.

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.

The invention discloses a water-jet scallop adductor muscle separating device. The device is composed of a clamping fixture (1), an angle adjusting mechanism (2), a separating nozzle (3), a washing nozzle (4), a transmission belt (5), and a support (6). The device is simple to operate, and the adductor muscle on scallop can be separated rapidly. The provided device can achieve automatic processing of scallop, improves the work environment, reduces the labor strength, and improves the work efficiency. Furthermore, the internal organs of scallop can be collected by the device, the post processing becomes more convenient, and the profits are increased.

The invention relates to a joint motion estimation method based on a myoelectricity and myotone model and unscented particle filtering. The method comprises the following steps: firstly, acquiring surface myoelectricity and muscle sound signals of biceps brachii muscle, triceps brachii muscle, radial brachii muscle, trapezius muscle, adductor muscle, anterior deltoid muscle, lateral deltoid muscleand pectoralis major muscle of an upper limb shoulder joint and an elbow joint of a human body in a synchronous continuous motion state, and respectively performing band-pass filtering processing; then, extracting Wilson amplitude and fuzzy entropy features of the surface myoelectricity and myotone signals; combining the physiological muscle model and joint kinematics through parameter substitution and simplification to form a joint motion model, and forming a measurement equation by using the extracted features to serve as feedback of the joint motion model to obtain a myoelectricity myotonestate space model; and finally, estimating the synchronous continuous motion of the shoulder joint and the elbow joint through an unscented particle filter algorithm. Compared with a traditional multi-joint synchronous continuous motion estimation method, the method has the advantage that the prediction precision and the real-time performance are obviously improved.

The invention discloses a method for rapidly detecting a content of scallop adductor muscle glycogen on site, which can realize determination of a glycogen content of adductor muscle food of scallopsthrough simple operations such as glycogen extraction by an alkali liquor, iodine solution color development, colorimetric card comparison and the like on site (culture sea areas, coasts, food processing workshops and other non-laboratory occasions). According to the method, a sample does not need to be transported to a laboratory, precise instruments such as a microplate reader, a spectrophotometer and the like do not need to be used, operation is easy and convenient, rapid detection of the adductor muscle glycogen content can be achieved, and a detection result is accurate.

The invention discloses a method for cultivating miniature seawater natural pearls through stimulation of calcium carbonate powder. The method comprises the following steps that firstly, the calcium carbonate powder and a dry powder injection machine are prepared; mature pearl shells are selected and opened; the calcium carbonate powder is correspondingly sprayed to adductor muscle parts, pallium surfaces and digestive blastocyst parts of the pearl shells once, and the calcium carbonate powder is dissolved and absorbed through pearl mother liquor; then the treated pearl shells are put into a seawater pond for recuperation; after recuperating, the pearl shells are put into seawater to be cultured for 3 months, the pearl shells are fished out, dead pearl shells are removed, attachments are cleaned, and pearl shells with generated pearl sacs are distinguished and screened out through an X-ray machine; and finally, the pearl shells with the generated pearl bags are put into seawater to be bred in a hanging mode for 10-12 months, and the cultivating process is completed. According to the method for cultivating the miniature seawater natural pearls through stimulation of the calcium carbonate powder, the process that foreign matter such as sand enters the shell bodies to generate pearls is simulated, the pearl shells form pearl bags and secrete nacre through stimulation of the calcium carbonate powder reserved in the shell bodies, and finally the seawater pearls with high nacre purity are obtained through cultivation and can serve as raw material components of medicines or cosmetics.

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.

The invention provides a method for measuring the adductor muscle tension of a bivalve. The method comprises the following steps of firstly, placing a scallop to be measured into an inflated circulating seawater system for ten minutes or above; debugging equipment and software, connecting a serial port, and performing an online test through data analysis software to determine that the equipment is successfully connected with the software; then, carrying out scallop tension detection, and after an upper clamping piece and a lower clamping piece are stably clamped by double shells of the scallop, starting measurement, wherein measurement time is 3 minutes; and finally, carrying out tension parameter analysis, exporting data to an excel table after measurement is finished, and carrying out calculation of four scallop tension indexes. By improvement of existing scallop tension measuring system equipment and establishment of a scallop tension index standardized measuring method, low-cost, high-efficiency and standardized measurement of scallop adductor muscle tension is realized, and a reliable technical means is provided for subsequent scallop breeding.

The invention provides a human body body hip modeling and simulation method based on muscle groups, and relates to the human body hip modeling and simulation method based on the muscle groups. The object of the method is to solve the problem that existing human hip models cannot take into account refined human body structures and finite element simulation implementing, and the human body hip modeling and simulation method based on the muscle groups is provided. The method comprises the steps of first, acquiring human hip image data; second, conducting geometric modeling on human hip, which includes geometric three-dimensional reconstruction of hip bone (cortical bone and cancellous bone), thigh bone (cortical bone and cancellous bone), articular cartilage, sartorius muscle, musculi quadriceps femoris, biceps femoris, semitendinosus, semimembranosus, gracilis, phalanges, long adductors, short adductors, adductor muscles, gluteus maximus, gluteus medius, gluteus maximus and entire hip; third, establishing muscle group models, conducting model assembly on the hip bone, the thigh bone, the articular cartilage, the muscle groups and the whole hip, establishing a fat and skin model, andadding tendon; fourth, determining meshing parameters, determining inter-tissue contact relationship, and implementing the meshing of the geometric models; fifth, attaching materials to the structureof each part of the human hip model, and determining the material parameters; sixth, achieving mechanical simulation of the human hip model. The method is used in the field of biomedical engineering.

The invention discloses a mussel-sourced biological adhesive for stomach recovery and a preparation method thereof. According to the mussel-sourced biological adhesive, mytilus coruscus or perna viridis which is abound in the southeastern coast of China is used as a material and adductor muscle with the thickness of no more than 4mm and ligaments and shells thereof are innovatively used as extracting objects; the extracting objects are extracted to obtain the biological adhesive. According to the technology disclosed by the invention, 1.06g of a crude extract adhesive and 0.42g of a water-soluble adhesive can be extracted from each 30 mussels averagely; in a whole preparation process, only less urea solution is needed; the mussel-sourced biological adhesive is convenient to prepare and low in cost and the preparation operation is convenient. The mussel biological adhesive prepared by the method disclosed by the invention has the characteristics of high yield, low cost, good biocompatibility, good adhesion effect and the like, also has a relatively good waterproof performance and has a wide market prospect.

The invention discloses a device and method for improving the fishing quality of mudflat shellfish products, which can enable shellfish to contract adductor muscles in advance to close shells before harvesting, and prevent the situations that the adductor muscles are not contracted in time due to sudden impact of high-pressure water flow in the shellfish harvesting process, the shells are not closed, mud and sand are poured into shellfish bodies, a strong stress reaction is caused, and the survival rate and the eating taste of the shellfish are directly influenced. Meanwhile, in the shellfish harvesting process, the device can collect a bottom mud sample of a mudflat shellfish culture area, and pressure data and vibration frequency data generated by rolling of the device are continuously collected through a pressure sensor and a vibration sensor. By applying the shellfish catching device, the stress reaction of shellfish can be reduced, and the quality of collected shellfish products is guaranteed. According to the substrate condition of the shellfish culture area, the variety and specification of shellfish suitable for bottom sowing in the sea area are selected. Catching strategies for different shellfish varieties and specifications are determined, and the shellfish catching quality and efficiency are improved.

The invention relates to a method for preparing a single-cell suspension of scallop muscle, which belongs to the technical field of marine invertebrate cell biology. The specific steps of the method are as follows: cutting the adductor muscle tissue into 1-2mm 3 Add enzyme mixture for complete digestion, transfer to centrifuge tube after digestion, collect cell sediment by centrifugation twice, add pre-cooled CMFSS solution to cell sediment, resuspend cells by pipetting, filter, add buffer again CMFSS, pipetting and resuspension, obtains scallop muscle single-cell suspension; the method of the present invention can realize low-cost, fast and high-efficiency acquisition of Ezo scallop muscle single-cell suspension, and ensure that the dissociated cells maintain good vitality, and can be applied to The dissociation, isolation and purification of other marine shellfish cells and the establishment of cell lines provide important reference materials for the study of single cells, gene functions and genetic breeding of Ezo scallop.

The invention relates to the field of marine animal and plant extraction, and concretely relates to an unfolding positioning type shell treatment device. The technical problem to be solved by the invention is to provide the unfolding positioning type shell treatment device. The unfolding positioning type shell treatment device comprises a first collecting frame plate, a turning and throwing separation mechanism, a position correcting mechanism, a shell and meat separation mechanism, a material conveying belt, a collecting basket, an electric rotating plate and the like. The upper part of a fixed support leg underframe is connected with a working machine tool plate. Subsequent treatment of shells in the seafood market is achieved, small-size shells which are not subjected to fleshing in fleshed shells are rapidly turned and separated, disordered shells are placed in order, all the fleshed shells are kept in the state that openings face upwards, then the shells with the openings facing upwards are opened and positioned, the shells with the openings facing upwards are placed in orderm adductor muscle muscles in the shells are rapidly separated, and the effect that the shells without meat residues are obtained is achieved.

The invention establishes a method for rapidly evaluating the quality characters of scallops based on a tension index. According to the method, the quality character of a scallop is rapidly evaluated according to the size of the tension of the adductor muscle of the scallop. By combining standardized measurement of the tension of the adductor muscles of scallops with a model for estimating the glycogen content through the tension index, a novel method for rapidly evaluating the quality characters of scallops is established, and a reliable technical means is provided for accurately evaluating the quality characters of scallops in the breeding work. According to the method, nondestructive tension detection is performed on scallops, and the obtained scallop tension index is used as a basis for rapidly evaluating the quality of scallops. Compared with a traditional scallop glycogen detection method, the method has the characteristics of high efficiency, simplicity, convenience, no damage and the like, and the scallop tension is used as an index for quickly evaluating the scallop quality for the first time. By adopting the method, technical support can be provided for improvement of quality characters of scallops.

The invention relates to a culture method of a new golden-yellow strain of Chlamys nobilis rich in natural carotenoid, which comprises the steps of: seed selection, single individual induced spawning,family establishment by monogam insemination, offspring seed culture, intermediate breeding and cultivating, color purification check, new strain multiplication and continuous selective breeding andthe like; and the new golden-yellow strain of the Chlamys nobilis rich in natural carotenoid can be cultured by two-generation directional selective breeding. The new strain has stable character, notonly has golden-yellow shell, adductor muscle and pallium, but also is rich in the natural carotenoid; averagely, 98% of individuals have golden-yellow shells, 96% of individuals have golden-yellow adductor muscle, 99% of individuals have golden-yellow pallium, and the total content of the carotenoid is 4.2-13.8 times of that of groups not subjected to the selective breeding. The invention culturea new strain of shellfish from the angles of the sensed color and the nutrition.

The invention discloses a low-damage shellfish blood drawing method. The method comprises the steps: selecting healthy individuals with sound appearance; weighing the selected individuals, and computing safe drawn blood volume; forming a micropore above a thick musculus adductor of one individual by a jewelry cutter; inserting the thick musculus adductor of Cyclina sinensis with a disposable sterile syringe by 0.5cm-1cm to draw blood, and controlling the drawn blood volume; placing the blood-drawn individual back into clean seawater for culture, and adding antibiotics into the water; and determining next blood drawing time according to recovery conditions of the Cyclina sinensis and experiment needs. According to the method, the problem of the traditional culture breeding that experiment data are lost due to death of parents is solved, blood can be drawn from the parents to extract required data when the parents still survive, and subsequent growth of the parents cannot be affected. Compared with the traditional lethal sampling method, the low-damage shellfish blood drawing method has the advantages that great damage to experimental animals is avoided, and the method has an important research significance and practical value in the aspects of endangered animal resource conservation, full-gene selective breeding of economic species, and the like.

The invention discloses a method for timely judging the low-temperature injury degree of chlamys nobilis. According to the invention, a timely chlamys nobilis low-temperature injury judgment standard is established, the digestive gland and adductor muscle of the chlamys nobilis are respectively subjected to fat and glycogen content detection, and the injury degree judgment standard is compared, specifically, low-temperature first-degree injury refers that the fat content of digestive glands is less than or equal to 40% and the glycogen content of adductor muscles is less than or equal to 15mg / g; low-temperature second-degree injury refers that the fat content of digestive glands is less than or equal to 45% and the glycogen content of adductor muscles is less than or equal to 20mg / g, and is higher than the first-degree injury standard; and low-temperature non-injury refers that the fat content of digestive glands is greater than 45% or the glycogen content of adductor muscles is greater than 20mg / g. According to the method, whether the chlamys nobilis is in the low-temperature injury state or not and the degree of the low-temperature injury state can be judged by detecting the fat content and the glycogen content, the degree of the low-temperature injury to parent scallops required by breeding can be judged in time, and support is provided for breeding of low-temperature-resistant varieties.

The invention relates to a germplasm identification method for Moerella iridescens, which is characterized by comprising the following steps: at least 30 Moerella iridescens samples to be measured are taken to undergo determination of 7 morphologic parameters, and the 7 morphologic parameters, namely the shell length CD of the Moerella iridescens, the maximum distance AF from the shell top to theanterior adductor muscle scar, the length IJ of the anterior border and the posterior border of a pallial scar, the length AE from the shell top to the posterior border of the pallial scar, the shellheight AB, the shell width SW and the distance GH between the anterior adductor muscle scar and the posterior adductor muscle scar are determined respectively; the parameter value of the shell lengthCD is taken as a denominator and the residual 6 parameter values are taken as numerators, and the following 6 proportion parameter vales are obtained: XAF:AF / CD, XIJ:IJ / CD, XAE:AE / CL, XAB:AB / CL, XSW:SW / CD and XGH:GH / CD; and the 6 proportion parameter values are substituted into a discriminant equation for result determination respectively, and a colony wherein the occurrence frequency of the maximum of the Y value obtained is maximum is taken as a source of the Moerella iridescens samples to be measured. The method can quickly, economically and relatively accurately identify the germplasm of the Moerella iridescens in main production places of China with simple and convenient operation.

The invention provides a method for quickly evaluating the resistance of bivalve mollusks based on a tension index, which is a method for detecting the tension index without damage on the basis of not influencing the activity of a tested individual and quickly evaluating the resistance of scallops based on the tension index. According to the method, efficient and lossless tension detection is carried out on the scallops, and the obtained four tension indexes including the total force, the shell closing time, the average force and the maximum force of the scallops serve as the basis for rapidly evaluating the scallop resistance. Compared with the traditional method, the method provided by the invention can realize nondestructive living body detection, and compared with a concentricity detection method, the method provided by the invention has the characteristics of being more stable, accurate, simple, convenient, high in detection success rate and the like. In addition, the tension of the adductor muscle of the scallop is used as an index for rapidly evaluating the resistance of the scallop for the first time. The method provided by the invention can provide reference for scallop resistance index determination, and provides technical support for subsequent breeding of scallop stress-resistant varieties.

The invention provides a method for hemocyte collection and ultra microstructure observation of seawater arcidae shellfish and belongs to the technical field of marine organism. The method can be usedfor collecting blood of arcidae shellfish living bodies, and the blood collecting site is blood sinus in adductor muscle close to the edge of the shell. The method disclosed by the invention can be used for collecting and separating blood cells in the condition of not damaging the shell body by improvement on the existing method for hemocyte collection and ultra microstructure observation of seawater arcidae shellfish, and can perform ultra microstructure observation on the collected blood cells. The method can overcome the limitations of less quantity and small figure of experiment shells, is simple and convenient in operation, and preserves the activated state of the blood cell and the normal form of the blood cell in an organism, and shell bodies can still survive after blood collection and restore to the normal healthy state, thus meeting the requirements of repeated experiment and comparison experiment.