Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

44 results about "Adductor muscles" patented technology

The adductor muscles are the main muscular system in bivalve mollusks, i.e. in clams, scallops, mussels, oysters, etc. In many parts of the world, when people eat scallops, the adductor muscles are the only part of the soft parts of the animal which are eaten. Adductor muscles leave noticeable scars or marks on the interior of the shell's valves. Those marks (known as adductor muscle scars) are often used by scientists who are in the process of identifying empty shells to determine their correct taxonomic placement.

Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Human body hip modeling and simulation method based on muscle groups

InactiveCN108334730AProven AccuracyMeet the requirements of finite element analysisEducational modelsSpecial data processing applicationsHuman bodyBone Cortex
The invention provides a human body body hip modeling and simulation method based on muscle groups, and relates to the human body hip modeling and simulation method based on the muscle groups. The object of the method is to solve the problem that existing human hip models cannot take into account refined human body structures and finite element simulation implementing, and the human body hip modeling and simulation method based on the muscle groups is provided. The method comprises the steps of first, acquiring human hip image data; second, conducting geometric modeling on human hip, which includes geometric three-dimensional reconstruction of hip bone (cortical bone and cancellous bone), thigh bone (cortical bone and cancellous bone), articular cartilage, sartorius muscle, musculi quadriceps femoris, biceps femoris, semitendinosus, semimembranosus, gracilis, phalanges, long adductors, short adductors, adductor muscles, gluteus maximus, gluteus medius, gluteus maximus and entire hip; third, establishing muscle group models, conducting model assembly on the hip bone, the thigh bone, the articular cartilage, the muscle groups and the whole hip, establishing a fat and skin model, andadding tendon; fourth, determining meshing parameters, determining inter-tissue contact relationship, and implementing the meshing of the geometric models; fifth, attaching materials to the structureof each part of the human hip model, and determining the material parameters; sixth, achieving mechanical simulation of the human hip model. The method is used in the field of biomedical engineering.
Owner:HARBIN UNIV OF SCI & TECH

SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Improved measuring device for tension of adductor muscles of bivalve shellfish

The present invention discloses an improved measuring device for tension of adductor muscles of bivalve shellfish. The improved measuring device comprises a base seat and two guide rods arranged in parallel at an upper side end of the base seat, upper ends of the guide rods are erected with a connecting plate, the guide rods are sleeved with a lifting block in a sliding way, transmission screw holes are arranged in an upper end surface and a lower end surface of the lifting block, and the transmission screw holes are provided with a lifting screw rod in a matching manner. The improved measuring device is designed aiming at disadvantages of the existing devices, can directly display measured data, realizes power output by using thread transmission, so that power input is more steady, in addition, an embedded design of two upper and lower tension plates greatly reduces thickness of the tension plates during insertion, damages to the shells during the insertion is avoided, stress surfacesof the two tension plates are both provided with elastic layers which help avoiding local stress of the shells to cause shell local rupture, and practicality is strong.
Owner:LUDONG UNIVERSITY

Nucleus insertion method in seawater pearl culture nucleus insertion and pearl culture operation

The invention discloses a nucleus insertion method in seawater pearl culture nucleus insertion and pearl culture operation. The method is characterized by comprising the steps that before an operation, all operation instruments are strictly disinfected, mother pearl shellfish is thoroughly cleaned, mouth plugging is carried out at first, a mouth opener is used for opening the two shells of mother pearl shellfish, then a wedge is plugged in to facilitate nucleus insertion, the pallium is cut and obtained, a scalpel is inserted into the rear ventral edge of saibo donors at first to cut off adductor muscle and divide the shellfish body into two parts, then shellfish gill is pushed aside, the pallium or an inner cushion thereof are cut off from the tail end of the gill below the chilidium, small cell pieces are manufactured, color line alignment is carried out, the pallium is finished, and finally nucleus insertion is carried out. The defects that culture benefits are low and the labor intensity is large in traditional, simple and rough nucleus insertion operation are overcome, seawater pearl culture is more scientific, and culture economic benefits are more remarkable.
Owner:郑波明

Breeding method for scallop hybridization breeding

The invention discloses a breeding method for scallop hybridization breeding. The breeding method is characterized by comprising the steps that firstly, gonad development synchronous breeding is carried out on selected chlamys farreri and Argopecten irradians; then, fully-developed female chlamys farreri in the chlamys farreri and the fully-developed Argopecten irradians are selected, after the female chlamys farreri finishes spawning, the hermaphroditic Argopectehs irradians is set for spermiation, and fertilization is carried out on sperms and eggs to form scallop hybridization fertilized eggs; incubation is carried out on the hybridization fertilized eggs, then larva selection is carried out, and larvas are bred in a larva breeding pond; finally the bred larvas are bred to scallop hybridization fry capable of being bred through settlement and metamorphosis. The hybridization scallop fry are bred from the female chlamys farreri and the Argopectehs irradias in a hybridization mode, and have the prominent advantages that in the breeding process, growing speed is high, resistance to diseases is high, the gonad is poor in fertility, the adductor muscle is large, the growing speed can be improved by more than 30 percent, the yield of primary products of the adductor muscle is improved by more than 40 percent, the obvious heterosis is achieved, and the sustainable development of scallop culture in China can be promoted.
Owner:莱州市曙光渔业有限公司

Manufacturing method of scallop color fan for measuring total carotenoid content in adductor muscles of scallops and application of scallop color fan

The invention relates to a manufacturing method of a scallop color fan for measuring the total carotenoid content in adductor muscles of scallops and application of the scallop color fan. The content range of the total carotenoid in the adductor muscles of each scallop can be obtained within 3-5 seconds by comparing the manufactured scallop color fan with the adductor muscle color of the scallop. The content range of the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is 10-250 Mu g / g. The manufacturing method of the scallop color fan for measuring the total carotenoid content in adductor muscles of scallops is simple and strong in operability. A method for measuring the measured total carotenoid in the adductor muscles of Chlamys nobilis Reeve is rapid, simple, convenient, high in efficiency, low in cost, easy to popularize, strong in practicability and strong in environmentally-friendly property.
Owner:SHANTOU UNIV

SNP298299 marker significantly correlated with pinctada martensii mollusc part weight and adductor muscle weight, as well as primers and application of SNP298299 marker

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Water-jet scallop adductor muscle separating device

InactiveCN104705382AMeet the needs of processing automation operationsImprove working environmentBivalves processingTransmission beltWorking environment
The invention discloses a water-jet scallop adductor muscle separating device. The device is composed of a clamping fixture (1), an angle adjusting mechanism (2), a separating nozzle (3), a washing nozzle (4), a transmission belt (5), and a support (6). The device is simple to operate, and the adductor muscle on scallop can be separated rapidly. The provided device can achieve automatic processing of scallop, improves the work environment, reduces the labor strength, and improves the work efficiency. Furthermore, the internal organs of scallop can be collected by the device, the post processing becomes more convenient, and the profits are increased.
Owner:HEBEI AGRICULTURAL UNIV.

Joint motion estimation method based on myoelectricity myotone model and unscented particle filtering

The invention relates to a joint motion estimation method based on a myoelectricity and myotone model and unscented particle filtering. The method comprises the following steps: firstly, acquiring surface myoelectricity and muscle sound signals of biceps brachii muscle, triceps brachii muscle, radial brachii muscle, trapezius muscle, adductor muscle, anterior deltoid muscle, lateral deltoid muscleand pectoralis major muscle of an upper limb shoulder joint and an elbow joint of a human body in a synchronous continuous motion state, and respectively performing band-pass filtering processing; then, extracting Wilson amplitude and fuzzy entropy features of the surface myoelectricity and myotone signals; combining the physiological muscle model and joint kinematics through parameter substitution and simplification to form a joint motion model, and forming a measurement equation by using the extracted features to serve as feedback of the joint motion model to obtain a myoelectricity myotonestate space model; and finally, estimating the synchronous continuous motion of the shoulder joint and the elbow joint through an unscented particle filter algorithm. Compared with a traditional multi-joint synchronous continuous motion estimation method, the method has the advantage that the prediction precision and the real-time performance are obviously improved.
Owner:HANGZHOU DIANZI UNIV

Method for rapidly detecting content of scallop adductor muscle glycogen on site

InactiveCN111044513ARealize determinationQuick checkMaterial analysis by observing effect on chemical indicatorIodine solutionsAdductor muscles
The invention discloses a method for rapidly detecting a content of scallop adductor muscle glycogen on site, which can realize determination of a glycogen content of adductor muscle food of scallopsthrough simple operations such as glycogen extraction by an alkali liquor, iodine solution color development, colorimetric card comparison and the like on site (culture sea areas, coasts, food processing workshops and other non-laboratory occasions). According to the method, a sample does not need to be transported to a laboratory, precise instruments such as a microplate reader, a spectrophotometer and the like do not need to be used, operation is easy and convenient, rapid detection of the adductor muscle glycogen content can be achieved, and a detection result is accurate.
Owner:DALIAN OCEAN UNIV

Method for cultivating seawater miniature natural pearls through stimulation of calcium carbonate powder

InactiveCN112655615AHigh purity pearlIncrease the rate of bead productionClimate change adaptationPisciculture and aquariaMaricultureEnvironmental engineering
The invention discloses a method for cultivating miniature seawater natural pearls through stimulation of calcium carbonate powder. The method comprises the following steps that firstly, the calcium carbonate powder and a dry powder injection machine are prepared; mature pearl shells are selected and opened; the calcium carbonate powder is correspondingly sprayed to adductor muscle parts, pallium surfaces and digestive blastocyst parts of the pearl shells once, and the calcium carbonate powder is dissolved and absorbed through pearl mother liquor; then the treated pearl shells are put into a seawater pond for recuperation; after recuperating, the pearl shells are put into seawater to be cultured for 3 months, the pearl shells are fished out, dead pearl shells are removed, attachments are cleaned, and pearl shells with generated pearl sacs are distinguished and screened out through an X-ray machine; and finally, the pearl shells with the generated pearl bags are put into seawater to be bred in a hanging mode for 10-12 months, and the cultivating process is completed. According to the method for cultivating the miniature seawater natural pearls through stimulation of the calcium carbonate powder, the process that foreign matter such as sand enters the shell bodies to generate pearls is simulated, the pearl shells form pearl bags and secrete nacre through stimulation of the calcium carbonate powder reserved in the shell bodies, and finally the seawater pearls with high nacre purity are obtained through cultivation and can serve as raw material components of medicines or cosmetics.
Owner:广东尊鼎珍珠有限公司

Staged targeting scallop adductor non-phosphorus water-retaining agent containing antifreeze glycopeptide and application thereof

The invention discloses a stage targeting scallop adductor non-phosphorus water-retaining agent containing antifreeze glycopeptide and application, and relates to the technical field of food additives. The antifreeze glycopeptide-containing stage targeting scallop adductor phosphorus-free water-retaining agent consists of an agent A and an agent B, and does not contain phosphate additives, the agent A is permeable anti-freezing liquid and is prepared from the following components in percentage by mass: 5.0 percent to 9.0 percent of trehalose, 3.0 percent to 5.0 percent of sorbitol, 0.8 percent to 1.5 percent of sodium citrate, 0.4 percent to 1.0 percent of compound amino acid, 0.01 percent to 0.1 percent of high-activity anti-freezing glycopeptide, 0.01 percent to 0.05 percent of vitamin C, 0.01 percent to 0.05 percent of rosemary extract and the balance of water. According to the antifreeze glycopeptide-containing phase-targeting scallop adductor non-phosphorus water-retaining agent and the application thereof, ice crystal damage and protein denaturation are inhibited from the source, and cell-level protection of scallop adductors is realized. Through detection, the unfreezing loss rate of the treated scallop adductor is as low as about 2.12%, the cooking loss rate is as low as about 10.63%, and the water retention capacity is close to that of a commercially available phosphate water retention agent and is remarkably superior to that of an existing non-phosphorus water retention agent.
Owner:正大云(青岛)生物科技有限公司

A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Method for measuring adductor muscle tension of bivalve

The invention provides a method for measuring the adductor muscle tension of a bivalve. The method comprises the following steps of firstly, placing a scallop to be measured into an inflated circulating seawater system for ten minutes or above; debugging equipment and software, connecting a serial port, and performing an online test through data analysis software to determine that the equipment is successfully connected with the software; then, carrying out scallop tension detection, and after an upper clamping piece and a lower clamping piece are stably clamped by double shells of the scallop, starting measurement, wherein measurement time is 3 minutes; and finally, carrying out tension parameter analysis, exporting data to an excel table after measurement is finished, and carrying out calculation of four scallop tension indexes. By improvement of existing scallop tension measuring system equipment and establishment of a scallop tension index standardized measuring method, low-cost, high-efficiency and standardized measurement of scallop adductor muscle tension is realized, and a reliable technical means is provided for subsequent scallop breeding.
Owner:OCEAN UNIV OF CHINA +1

Breeding method for orange-adductor-muscle scallop

The present invention relates to a method in the field of shellfish breeding techniques, for breeding a scallop population that have improved carotenoid content in the orange-red adductor muscles or other muscle tissues. This method includes the steps of selecting the rare individuals that have orange-red adductor muscles from natural scallop populations, growing the selected scallops, inducing the reproduction, artificially fertilization, and finally breeding a scallop population with orange-red adductor muscles which can be expanded for the cultivation on a large scale. Comparing to other known breeding methods, the present method does not use transgenic technologies to include introduce any exogenous genes, thus does not have any bio-safety and ethics issues. All the mutant scallops with orange-red adductor muscles are selected from natural or cultivated populations. After breeding for four generations, the obtained scallops have abundant carotenoid ingredients in their orange-red adductor muscles. The obtained scallop population is genetically stable and has high survival rate, and it thus can be used for cultivation on a large scale. In summary, this breeding method is simple, low cost and the breeding scallop population has high economic and nutritious values.
Owner:OCEAN UNIV OF CHINA

A snp411871 marker associated with shell type and weight size of Pinctada martensii and its primers and applications

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

A method for parentage identification in tetraploid oysters based on SNP loci

This invention discloses a method for identifying the parentage of tetraploid Pacific oysters based on SNP loci, belonging to the field of molecular-assisted breeding technology for tetraploid Pacific oysters. The method includes the following steps: (1) sequencing the adductor muscle of the tetraploid Pacific oyster to be tested; (2) comparing the genotype of the designated SNP locus in the tetraploid Pacific oyster with the reference genome; (3) calculating the IBS and LOD of all tested parents and offspring based on the SNP typing results; and (4) combining the IBS and LOD to identify the parentage of the tested parents and offspring. The advantages of this invention are: it discloses for the first time 1000 SNP loci for identifying the parentage of tetraploid Pacific oysters, providing data support for the identification of parentage in tetraploid Pacific oysters and laying the foundation for the development of liquid-phase chips for identifying the parentage of tetraploid Pacific oysters, showing good application prospects.
Owner:LUDONG UNIVERSITY +2

A Modeling and Simulation Method of Human Hip Based on Muscle Group

InactiveCN108334730BMeet the requirements of finite element analysisProven AccuracyMedical simulationEducational modelsBone CortexCortical bone
The invention provides a human body body hip modeling and simulation method based on muscle groups, and relates to the human body hip modeling and simulation method based on the muscle groups. The object of the method is to solve the problem that existing human hip models cannot take into account refined human body structures and finite element simulation implementing, and the human body hip modeling and simulation method based on the muscle groups is provided. The method comprises the steps of first, acquiring human hip image data; second, conducting geometric modeling on human hip, which includes geometric three-dimensional reconstruction of hip bone (cortical bone and cancellous bone), thigh bone (cortical bone and cancellous bone), articular cartilage, sartorius muscle, musculi quadriceps femoris, biceps femoris, semitendinosus, semimembranosus, gracilis, phalanges, long adductors, short adductors, adductor muscles, gluteus maximus, gluteus medius, gluteus maximus and entire hip; third, establishing muscle group models, conducting model assembly on the hip bone, the thigh bone, the articular cartilage, the muscle groups and the whole hip, establishing a fat and skin model, andadding tendon; fourth, determining meshing parameters, determining inter-tissue contact relationship, and implementing the meshing of the geometric models; fifth, attaching materials to the structureof each part of the human hip model, and determining the material parameters; sixth, achieving mechanical simulation of the human hip model. The method is used in the field of biomedical engineering.
Owner:HARBIN UNIV OF SCI & TECH

A device and method for improving the quality of tidal flat shellfish harvesting

ActiveCN112956458BThere will be no phenomenon of choking into the body of shellfishReduce stress responseClimate change adaptationPisciculture and aquariaTidal flatWater flow
The invention discloses a device and a method for improving the harvesting quality of tidal flat shellfish products. The invention can make the shellfish shrink the adductor muscle to tightly close the shellfish before harvesting, and prevent the shellfish from being suddenly subjected to high pressure during the harvesting process. The impact of the water flow causes the adductor muscle to not contract in time, and the unclosed shell causes mud and sand to enter the shell, resulting in a strong stress response, which directly affects the survival rate and eating taste of the shellfish; at the same time, during the harvesting process of the shellfish, the The device can collect sediment samples from tidal flat shellfish breeding areas, and continuously collect pressure data and vibration frequency data generated by the rolling of the device through pressure sensors and vibration sensors; the application of the shellfish harvesting device of the present invention can reduce shellfish stress response to ensure the quality and quality of harvested shellfish products; according to the substrate conditions of the shellfish farming area, select the suitable bottom-sowed shellfish species and specifications in the sea area; and determine the harvesting strategies for different shellfish varieties and specifications to improve Shellfish Harvesting Quality and Efficiency.
Owner:山东省海洋科学研究院青岛国家海洋科学研究中心

Mussel-sourced biological adhesive for stomach recovery and preparation method thereof

ActiveCN107281538AIncrease productionLow costSurgical adhesivesAdhesiveBiocompatibility Testing
The invention discloses a mussel-sourced biological adhesive for stomach recovery and a preparation method thereof. According to the mussel-sourced biological adhesive, mytilus coruscus or perna viridis which is abound in the southeastern coast of China is used as a material and adductor muscle with the thickness of no more than 4mm and ligaments and shells thereof are innovatively used as extracting objects; the extracting objects are extracted to obtain the biological adhesive. According to the technology disclosed by the invention, 1.06g of a crude extract adhesive and 0.42g of a water-soluble adhesive can be extracted from each 30 mussels averagely; in a whole preparation process, only less urea solution is needed; the mussel-sourced biological adhesive is convenient to prepare and low in cost and the preparation operation is convenient. The mussel biological adhesive prepared by the method disclosed by the invention has the characteristics of high yield, low cost, good biocompatibility, good adhesion effect and the like, also has a relatively good waterproof performance and has a wide market prospect.
Owner:SOUTHERN MEDICAL UNIVERSITY

Crassostrea hongkongensis VgR gene as well as shRNA-VgR sequence and application thereof

The invention discloses a Crassostrea hongkongensis VgR gene and an shRNA-VgR sequence and application thereof, a VgR gene segment is obtained by screening and cloning from a Crassostrea hongkongensis transcriptome, shRNA is designed and synthesized according to the Crassostrea hongkongensis VgR gene sequence, and the shRNA is named as shRNA-VgR. The method comprises the following steps: introducing the VgR gene into Crassostrea hongkongensis by injecting adductor muscle to interfere and inhibit the expression of the VgR gene in the Crassostrea hongkongensis, detecting the expression and location distribution change of the interfered VgR gene, the activity change of related signal channel key genes and key enzymes regulated by the VgR gene, the morphological structure change of related tissues, the cell apoptosis condition and the like, and identifying the Crassostrea hongkongensis in the Crassostrea hongkongensis. And systematically analyzing the effect of the VgR gene and the regulatory pathway thereof in the physiological process of the crassostrea hongkongensis and the regulatory mechanism thereof. The injection dosage is small, the cost can be reduced, and regulation and control of VgR-guided related signal channels on physiological functions of crassostrea hongkongensis can be effectively influenced.
Owner:BEIBU GULF UNIV

Device and method for improving fishing quality of mudflat shellfish products

ActiveCN112956458AThere will be no phenomenon of choking into the body of shellfishReduce stress responseClimate change adaptationPisciculture and aquariaWater flowEnvironmental engineering
The invention discloses a device and method for improving the fishing quality of mudflat shellfish products, which can enable shellfish to contract adductor muscles in advance to close shells before harvesting, and prevent the situations that the adductor muscles are not contracted in time due to sudden impact of high-pressure water flow in the shellfish harvesting process, the shells are not closed, mud and sand are poured into shellfish bodies, a strong stress reaction is caused, and the survival rate and the eating taste of the shellfish are directly influenced. Meanwhile, in the shellfish harvesting process, the device can collect a bottom mud sample of a mudflat shellfish culture area, and pressure data and vibration frequency data generated by rolling of the device are continuously collected through a pressure sensor and a vibration sensor. By applying the shellfish catching device, the stress reaction of shellfish can be reduced, and the quality of collected shellfish products is guaranteed. According to the substrate condition of the shellfish culture area, the variety and specification of shellfish suitable for bottom sowing in the sea area are selected. Catching strategies for different shellfish varieties and specifications are determined, and the shellfish catching quality and efficiency are improved.
Owner:山东省海洋科学研究院青岛国家海洋科学研究中心

A kind of method for preparing scallop muscle single cell suspension

ActiveCN110846271BEasy accessEfficiently obtainedCell dissociation methodsInvertebrate cellsMarine invertebratesSingle cell suspension
The invention relates to a method for preparing a single-cell suspension of scallop muscle, which belongs to the technical field of marine invertebrate cell biology. The specific steps of the method are as follows: cutting the adductor muscle tissue into 1-2mm 3 Add enzyme mixture for complete digestion, transfer to centrifuge tube after digestion, collect cell sediment by centrifugation twice, add pre-cooled CMFSS solution to cell sediment, resuspend cells by pipetting, filter, add buffer again CMFSS, pipetting and resuspension, obtains scallop muscle single-cell suspension; the method of the present invention can realize low-cost, fast and high-efficiency acquisition of Ezo scallop muscle single-cell suspension, and ensure that the dissociated cells maintain good vitality, and can be applied to The dissociation, isolation and purification of other marine shellfish cells and the establishment of cell lines provide important reference materials for the study of single cells, gene functions and genetic breeding of Ezo scallop.
Owner:YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Method and apparatus for cooling food and the like

To provide a refrigerating method and a continuous refrigerating device capable of maintaining the endurance and space-saving property of the refrigerating device, and excellently refrigerating even foods such as Scallop Adductor Muscle.SOLUTION: A cooler disposed in a space below the forward path, wherein a height between the forward path and an inner upper surface of the housing is reduced while securing passage of food or the like, a plurality of nozzles are provided between the forward path and the cooler, first and second ducts are provided at different positions in a longitudinal direction of the conveyor, and cold air in the cold air treatment space is introduced into both the nozzles and the first duct, in the cooling method, cold air is injected from a nozzle to a lower surface of a forward path of a conveyor, the cold air is sent out from a first duct onto the forward path of the conveyor, and the cold air moves on the forward path of the conveyor toward an intake side of a second duct.SELECTED DRAWING: Figure 4
Owner:TAKAHASHI GALILEI CO LTD

Unfolding positioning type shell treatment device

InactiveCN112159139AImplement follow-up processingArrange neatlyAnimal scienceAdductor muscles
The invention relates to the field of marine animal and plant extraction, and concretely relates to an unfolding positioning type shell treatment device. The technical problem to be solved by the invention is to provide the unfolding positioning type shell treatment device. The unfolding positioning type shell treatment device comprises a first collecting frame plate, a turning and throwing separation mechanism, a position correcting mechanism, a shell and meat separation mechanism, a material conveying belt, a collecting basket, an electric rotating plate and the like. The upper part of a fixed support leg underframe is connected with a working machine tool plate. Subsequent treatment of shells in the seafood market is achieved, small-size shells which are not subjected to fleshing in fleshed shells are rapidly turned and separated, disordered shells are placed in order, all the fleshed shells are kept in the state that openings face upwards, then the shells with the openings facing upwards are opened and positioned, the shells with the openings facing upwards are placed in orderm adductor muscle muscles in the shells are rapidly separated, and the effect that the shells without meat residues are obtained is achieved.
Owner:陈泽鑫

Method for evaluating quality characters of scallops based on tension index

ActiveCN113933471ARapid assessment of quality traitsImprove quality traitsApparatus for force/torque/work measurementTesting foodAdductor musclesData mining
The invention establishes a method for rapidly evaluating the quality characters of scallops based on a tension index. According to the method, the quality character of a scallop is rapidly evaluated according to the size of the tension of the adductor muscle of the scallop. By combining standardized measurement of the tension of the adductor muscles of scallops with a model for estimating the glycogen content through the tension index, a novel method for rapidly evaluating the quality characters of scallops is established, and a reliable technical means is provided for accurately evaluating the quality characters of scallops in the breeding work. According to the method, nondestructive tension detection is performed on scallops, and the obtained scallop tension index is used as a basis for rapidly evaluating the quality of scallops. Compared with a traditional scallop glycogen detection method, the method has the characteristics of high efficiency, simplicity, convenience, no damage and the like, and the scallop tension is used as an index for quickly evaluating the scallop quality for the first time. By adopting the method, technical support can be provided for improvement of quality characters of scallops.
Owner:OCEAN UNIV OF CHINA +1

Culture method of new golden-yellow strain of Chlamys nobilis rich in natural carotenoid

The invention relates to a culture method of a new golden-yellow strain of Chlamys nobilis rich in natural carotenoid, which comprises the steps of: seed selection, single individual induced spawning,family establishment by monogam insemination, offspring seed culture, intermediate breeding and cultivating, color purification check, new strain multiplication and continuous selective breeding andthe like; and the new golden-yellow strain of the Chlamys nobilis rich in natural carotenoid can be cultured by two-generation directional selective breeding. The new strain has stable character, notonly has golden-yellow shell, adductor muscle and pallium, but also is rich in the natural carotenoid; averagely, 98% of individuals have golden-yellow shells, 96% of individuals have golden-yellow adductor muscle, 99% of individuals have golden-yellow pallium, and the total content of the carotenoid is 4.2-13.8 times of that of groups not subjected to the selective breeding. The invention culturea new strain of shellfish from the angles of the sensed color and the nutrition.
Owner:石佳媛

A method for nondestructive detection of EPA and DHA content in the adductor muscle of scallops based on Raman spectroscopy

The application provides a method for nondestructive detection of the contents of EPA and DHA in scallop adductor muscle based on Raman spectrum, which comprises the following steps: firstly, a proper amount of gill filament tissue is taken from a living scallop by a nondestructive method, and then a frozen section is prepared; secondly, the section is subjected to Raman laser scanning to obtain original data; and finally, after pretreatment such as normalization, noise reduction and baseline correction, a characteristic wavelength is selected, and a model for predicting the content of unsaturated fatty acid in the adductor muscle by using the gill filament Raman data across tissues is established in combination with the lipid group data of the adductor muscle. Compared with the existing method for detecting the content of unsaturated fatty acid in scallops, the determination method of the application can realize the rapid, accurate and simple detection of the content of unsaturated fatty acid in the main edible part, i.e., the striated muscle of scallops, under the condition of ensuring the survival of scallops, and greatly reduces the detection cost, thereby providing an efficient and simple technical means for the breeding of shellfish quality traits, and being beneficial to the popularization and promotion in the comprehensive evaluation and genetic improvement of aquatic germplasm.
Owner:OCEAN UNIV OF CHINA