Supercharge Your Innovation With Domain-Expert AI Agents!

A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications

A technology of 298299RI, Pinctada martensii, applied in the field of aquatic animal genetics and molecular marker-assisted breeding, which can solve the problems of weakened pearl breeding ability, small size of individuals, and deterioration of breeding environment.

Active Publication Date: 2017-03-22
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of the reasons, apart from the deteriorating breeding environment and backward breeding technology, there is another important reason: no attention has been paid to the selection and preservation of seed oysters for many years, and there is a lack of good varieties; , such as slow growth, small size, weakened pearl breeding ability, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications
  • A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications
  • A SNP298299 marker significantly associated with soft body weight and adductor muscle weight of Pinctada martensii and its primers and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Randomly take 96 Pinctada martensii individuals from the same group, after cleaning, take their soft parts and weigh them, then take their adductor muscle tissues, weigh them and record them one by one, and take a small piece of adductor muscle Tissues were stored in 95% ethanol at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA from the adductor muscle of 96 Pinctada martensii individuals. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.

[0031] The detection primers for the SNP298299 marker associated with the soft body weight and adductor muscle weight of Pinctada martensii are:

[0032] 298299FI:GGAATTCGTATCACTGTTTGAAGCAAGG;

[0033] 298299RI:GGGAACACATCCCACATTTAACAATGTTA;

[0034] 298299FO...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP298299 marker significantly correlated with a pinctada martensii mollusc part weight and an adductor muscle weight, as well as and primers and application of the SNP298299 marker. The primers comprise 298299FI: GGAATTCGTATCACTGTTTGAAGCAAGG, 298299RI: GGGAACACATCCCACATTTAACAATGTTA, 298299FO: TTGATAGCGGAATAGGCACATTCAATTT, and 298299RO: TTAAAAGGCAAAGAAAACTTTGGCATCAG. Two types of SNP (single nucleotide polymorphism) genotype loci can be amplified by utilizing the primers disclosed by the invention and then according to a PCR (Polymerase Chain Reaction) electrophoretogram, the mollusc part weight and the adductor muscle weight can be visually compared between individuals; and the primers can be directly used for subsequent molecular marker assistant breeding.

Description

[0001] Technical field: [0002] The invention belongs to the technical field of aquatic animal genetics and molecular marker-assisted breeding, and specifically relates to a SNP298299 marker, a primer and an application thereof that are significantly correlated with the soft body weight and adductor muscle weight of Pinctada martensii. [0003] Background technique: [0004] Pinctada martensii is the main species of pearl culture in my country and the world. Since the successful artificial breeding of Pinctada martensii in my country in 1965, the seawater pearl industry has developed rapidly and has become one of the pillar industries of mariculture in Guangdong, Guangxi and some coastal areas of Hainan. In the past 10 years, the quality and output of seawater pearls in my country have declined significantly, the international competitiveness has weakened, and the economic benefits of breeding have declined. In terms of the reasons, apart from the deteriorating breeding envir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/158
Inventor 何毛贤李耀国
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More