98 results about "Pinctada martensii" patented technology

The invention discloses a method for preparing pinctada martensii high F value oligopeptide by an enzymatic method, relates to enzymatic hydrolysis of a pinctada martensii meat protein and desorption of an aromatic amino acid in a hydrolysate by adopting an effective separation means, and provides a method for preparing an oligopeptide mixture with the molecular weight of less than 2,000 Da and the F value (the molar ratio of a branched chain amino acid to the aromatic amino acid) of more than 20 by adopting the enzymatic hydrolysis of the pinctada martensii meat protein and an adsorbent adsorption and separation desorption effect. In the method, an aquatic animal protein is first taken as a raw material to prepare the high F value oligopeptide; the raw material is extracted by using hot water in a preparation process, the extract can be used for extracting taurine, and the precipitated protein is taken as an enzymatic substrate, so that the resource is utilized fully and effectively; a single enzyme, namely pancreatin is used as the preferred active enzyme; and the aromatic amino acid is desorbed by adopting a method of combining activated carbon static adsorption and gel filtration chromatography to prepare a high F value oligopeptide product.

The invention provides a method for producing anti-fatigue oral liquids by using Pinctada martensii dunker meats, which comprises the following steps: pounding the Pinctada martensii dunker meats into pulps by a high-speed tissue blender; adding No.6 light petrol to stir and degrease the pulps for removing fishy smell; carrying out centrifugation on the pulps, removing the No.6 light petrol; collecting the Pinctada martensii dunker meat pulps, and adding water to the meat pulps for even mixing, heating the mixed meat pulps; adding trypsin for enzymolysis according to weight of the martensii meat pulps, and inactivating the trypsin after the enzymolysis finishes; adding papain for enzymolysis according to weight of the martensii meat pulps, and inactivating the papain after the enzymolysis finishes; and adding alkali protease for enzymolysis according to weight of the martensii meat pulps, inactivating the alkali protease after the enzymolysis finishes, and cooling the pulps to the room temperature. Aqueous solution is collected by centrifugation and then is subject to vacuum concentration; the concentrated pulps are diluted with aquae sterilisata to obtain required pulps; and ethyl maltol, citric acid and sodium cyclamate are added to the pulps for dissolution and homogeneous mixing to prepare the products. In the invention, the technology is simple and easy to operate, production cycle is shorter, and the proteins of the Pinctada martensii meats are subject to three-enzyme composite hydrolysis to enhance the amount of the produced amino acid and small peptide obviously, thus being beneficial to improving product quality.

The invention relates to a breeding method for a rapid growing line of seawater pearl shells, which comprises the steps of: taking a certain population of Pinctada martensii Dunker as a basic population, firstly selecting individuals with shell width being 10-40 percent higher than average value from the basis population by taking shell width as a selection index, then selecting individuals with shell height or weight being 10-60 percent higher than average value as breeding parents, dissecting the breeding parents, taking sexual glands to conduct artificial insemination, selecting and reserving preparative parents at a young shell stage according to a proportion of 20-30 percent, and finally conducting more than three generations of continuous selection to obtain the rapid-growing large excellent Pinctada martensii Dunker line (variety). The breeding method has the advantages that the method is simple, convenient and feasible, the cost for nursing the parents can be reduced, the growth speed and the individual size of the Pinctada martensii Dunker can be effectively improved and the pearl producing effect is improved.

The invention relates to a process for preparing japanese pearl oyster antihypertensive peptides, which is characterized in that the japanese pearl oyster antihypertensive peptides are prepared through adopting alkaline protease to hydrolyze japanese pearl oyster flesh and an enzymatic membrane reactor. The process for preparation comprises following steps: disintegrating the japanese pearl oyster flesh to prepare slurry and heating until denaturation, using water to dilute and obtain reaction solution, continuingly adding the reaction solution into the enzymatic membrane reactor, reacting and separating, continuingly penetrating hydrolysis completed liquid through films and flowing out the enzymatic membrane reactor, spraying and drying the hydrolysis completed liquid, and thereby obtaining the product of japanese pearl oyster antihypertensive peptides whose protein hydrolysis yield is 40-70% and IC50 is 0.3-0.6mg / ml. The process for preparation has high product yield and low production cost and is suitable for scale production and the product can reach the requirement of general functional food.

The invention discloses a seed production method for breeding pinctada martensii, which comprises the following steps: selecting individuals with obvious characteristic of golden yellow shell color from wild or bred colonies as parents to perform colony sex so as to establish basic colonies; performing colony selection on the basic colonies according to the characteristics of shell color and shell weight index; and after the selection of 3 to 5 generations, selecting the colonies in which the proportion of the golden yellow shell individuals can reach 95 percent and the shell weight index is improved by over 20 percent. The method for breeding a new pinctada martensii strain with obvious characteristics of shell color and shell weight index by using the golden yellow shell individuals of the wild or bred colonies as parents has stronger operability and can realize industrialized production.

The invention discloses a shellfish flavor peptide and a preparation method thereof. The method comprises the following steps: using pinctada martensii and Corbicula fluminea as raw materials, and beating; rinsing by using a NaCl solution and filtering to obtain protein; conducting glycosylation: dispersing the protein into the NaCl solution to let the protein uniformly mix with glucan in a proper weight ratio, then conducting freeze drying and dry heating to obtain glucan shellfish protein; conducting enzymatic hydrolysis: adding water in the glucan shellfish protein, adjusting the pH value and the temperature, adding papain and composite protease to conduct enzymatic hydrolysis, after completing the enzymatic hydrolysis, killing enzyme to obtain an enzymoiysis product; carrying out centrifugal filtration on the enzymoiysis product to obtain an enzymatic hydrolysis solution; fermenting to remove fishy smell: carrying out autoclaved sterilization on the enzymatic hydrolysis solution, cooling, inoculating lactic acid bacteria, fermenting to obtain a broth; carrying out ultrafiltration on the broth by using a 5000Da ultrafilter membrane and drying to obtain the flavor peptide. The shellfish flavor peptide prepared by the invention has rich nutrients on the basis of keeping the original taste and guarantees the food safety.

The invention relates to a method for producing Malpighian mother-of-pearl in red shell color, comprising the following steps: (1) seed preparing: choosing out one female and one male shell with apparent red shell color from bred family with high purity of shell color or from wild or breeding group, single mating and culturing with every single mating group; (2) expanding breeding: breeding for several generations with methods mentioned above, expanding breeding after the red shell proportion is over 90%, matching every single mated group for group mating or mating the female plant of single mated group with male plant from wild or breeding group. The seed of expanded breeding is used as cell shell and pearl-breeding shell for red shell pearl cultivation. The invention can prepare pearl of red shell color with relatively simple process, the purity of red shell is increased to 96% in maximum, and there is no need of external gene through trans-gene and other complicate technique, for which the product is safe for biology and environment.

The invention belongs to the technical field of pearl cultivation and particularly relates to a method of cultivating Pinctada martensii to produce luminous pearls. The method includes the steps of 1, grinding shells of Pinctada martensii into pearl nuclei, and covering each pearl nucleus with nano-sliver, a luminous sub-layer and a cold water sol layer to obtain luminous nuclei 3mm in diameter; 2, subjecting the luminous nuclei to nucleus implantation so as to obtain pearly shells; 3, cultivating the pearly shells to obtain the luminous pearls. The method is scientific and reasonable; the use of the pearl nuclei 3mm in diameter helps reduce the harm of the pearly shells caused by nucleus implantation, thus reducing mortality rate and nucleus rejecting rate of the pearly shells and increasing pearl yield and rate of high-quality pearls, and the method has a promising market.

The invention relates to a stage-by-stage pinctada martensii colony selective breeding method. The method comprises the following steps of: collecting 3 to 5 pinctada martensii breeding colonies from different sea areas; screening out individuals with the shell length 15 to 20 percent longer than the average shell length from each colony to serve as alternative parent mollusk; marking the alternative parent mollusks respectively to breed, wherein the selection intensity is 10 to 15 percent; performing secondary breeding; selecting 40 to 60 individuals with mature gonads respectively from eachalternative parent mollusk colony; dissecting and scissoring the gonads and mixing sperms and ova respectively to perform artificial insemination; and performing optimization in a metamorphosis period, a juvenile mollusk period, an adult mollusk period and a parent mollusk period, wherein the selection and remain rate is 50 to 60 percent and a fast-growth excellent variety (system) can be cultivated after selection of 4 to 5 generations. The method has the advantages that: a fast-growth and high-stress-resistance excellent new variety suitable for culture sea areas environment in China can becultivated by performing the stage-by-stage colony selection on multi-generation pinctada martensii; and the selective breeding method is simple and practicable and scale production can be realized.

The invention discloses a preoperative processing method during the nucleus insertion and the pearl culture of pinctada martensii, which is characterized by comprising the following steps of: (1) placing pinctada martensii in a preoperative processing frame, and hanging the frame to culture the pinctada martensii in sea water with 5-6 m in depth; (2) after hanging and culturing for 6-7 days, hanging the pinctada martensii in shallow water, namely in sea water with 0.5-1 m in depth, and after 30-32 hr, continuing hanging and culturing the pinctada martensii in water with 5-6 m in depth until the pinctada martensii are in a low activity state and can be subjected to an manual nucleus insertion operation. When the pinctada martensii processed by the method are applied to the manual nucleus insertion operation, the survival rate during a recovery period can reach more than 92.0 percent, and the nucleus retaining rate can reach more than 81.9 percent. The survival rate and the nucleus retaining rate of the pinctada martensii after nucleus insertion are greatly increased, and the problems of death and nucleus spitting of the pinctada martensii after the nucleus insertion operation are solved.

The invention discloses a method for producing seeds of golden shell colored pinctada martensii. The process for studying genetic breeding of pinctada martensii discovers that the characters of golden shell surface and golden pallial edge can be inherited, so that pinctada martensii having golden lip (the pallial edge is golden) and golden shell appearance can be easily cultivated, the proportion of golden shell color can be more than 60 percent without transgenosis or chemal treatment and other complicated technologies, and the product does not influence biological and environmental safety. According to the golden shell colored pinctada martensii, the death rate and pearl yield of pearly shellfish can be reduced, and the economical benefit of the product can be increased.

The invention relates to novel maintenance liquid for mantle pieces of pinctada martensii and a preparation method thereof. The maintenance liquid consists of NaCl, KCl, MgCl2, CaCl2 and prednisone acetate. The preparation method comprises the steps of: weighing and dissolving the NaCl, the KCl, the MgCl2, the CaCl2 and the prednisone acetate into double distilled water sequentially; and regulating a PH value to between 7.8 and 8.0 by adopting NaHCO3. The maintenance liquid has the advantages that the process is simple, the cost is low, the nucleus retaining rate and the high-quality pearl rate of pearl-culturing mollusk of the pinctada martensii can be improved obviously, and the quality and yield of pearls are improved.

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.

The invention discloses a good nacre cultivating method for pinctada martensii. The method comprising the flowing steps: (1) from a certain wild pinctada martensii group, selecting individuals which are larger than 20mm in shell width and larger than 0.35 in ratio of the shell width and the shell height as breeding parents; (2) from the breeding parents, selecting more than 30 female individuals with mature sexual glands and more than 20 male individuals, taking sperms and eggs through cutting, conducting artificial insemination, and breeding spat young shells; (3) consecutively selecting parents according to the step (1) and breeding spat young shells according to the step (2) for more than three generations when bred spat young shells reach 1.5-2.0 years. Consequently, obtained spat young shells can be used for large-scale production breeding and cultivation. The good nacre cultivating method for the pinctada martensii can remarkably improve the forms of shells and enable the shell to be thick, is suitable for core insertion pearl cultivation, and can reduce death and improve pearl cultivation characters.

The invention relates to a method of desalting culturing for pinctada martensii dunker. In the method, pinctada martensii dunker is cultured into a little oyster in seawater and then is transferred to a culturing pool with the same or similar seawater salinity for culturing; reducing the salinity in the culturing pool by 0.004 to 0.005 every week until the salinity is reduced to 1.000 to 1.010, then the desalting culturing of the pinctada martensii dunker is finished. The desalting culturing method of the invention reduces culturing cost, enlarges the culturing area of pinctada martensii dunker, improves the growing speed of pinctada martensii dunker, increases the output and quality of pearls and greatly improves the economic benefits of pinctada martensii dunker culture.

The invention discloses a postoperative low-specific-gravity seawater recuperation method for pinctada martensii after nucleus implantation, and belongs to the technical field of aquaculture. The method comprises the basic steps of preparation of a postoperative recuperation pond of pinctada martensii, preparation of recuperation water, selection and nucleus implantation of pearl breeding shellfishes and recuperation management of the pearl breeding shellfishes, wherein in the nucleus implantation and pearl breeding processes of pinctada martensii, healthy pinctada martensii is selected for nucleus implantation and pearl breeding and transferred into the indoor or outdoor pond for low-specific-gravity seawater recuperation after an operation, and after the recuperation is finished, pinctada martensii is transferred to a sea area for breeding of the pearl breeding shellfishes according to a conventional method. By means of the method, pinctada martensii is subjected to postoperative recuperation, the nucleus maintaining rate of the operative shellfishes is high, the rate of high-quality pearl is high, the pearl quality and economic benefit of the pearl breeding shellfishes can be improved, and the method is suitable for postoperative recuperation of the pearl breeding shellfishes of pinctada martensii, is easily applied and popularized in production enterprises and has significant economic and social benefits.

The invention discloses a method of utilizing methods of molecular biology and gene engineering to construct a polyploid tandem gene pBluescriptIIKS-nPFWM, a Pichia pastoris tandem expression vector pPICZ alpha A-pBluescriptIIKS-nPFWM and a Pichia pastoris engineering strain GS115-pPICZ alpha A-pBluescriptIIKS-nPFWM1, wherein n is 1, 2, 4, 6 or 12. A foundation is laid for subsequent efficient and stable expression of antioxidant peptide, industrialized large-scale production and application in the field of cosmetics and healthcare food.

The invention discloses a cultivating method of a new breeding strain of pinctada martensii with high carotenoid content. The cultivating method comprises the basic steps of parent selection, population construction, larval cultivation, sea area breeding and multi-generation population selection, and the new breeding strain of pinctada martensii with the high carotenoid content can be cultivated; for the obtained new strain, prismjatic layers of 96% of individuals are golden yellow, pallia, adductor muscles and gill filaments of 96% of the individuals are golden yellow, and the carotenoid content in pinctada martensii is 2-5 times that of control population. The new strain of pinctada martensii with the high carotenoid content is cultivated through a population selection breeding technology, obvious golden yellow is achieved, and the carotenoid content in pinctada martensii is high; the method is easy to popularize in production units and has a significant practical value and economic value.

The invention belongs to the pearl cultivation field, and particularly relates to a cultivation method of colorful seawater pearls. The cultivation method of the colorful seawater pearls includes: implanting small slices formed by cutting palliums of abalones or mussels in gonad of pinctada martensii; then, tightly attaching pearl nuclei to the small slices so as to implant the pearl nuclei; cultivating the pinctada martensii in seawater after recuperation so as to obtain the colorful seawater pearls. The cultivation method of the colorful seawater pearls uses the characteristic of being bright in nacre color of the abalones or the mussels, uses the abalones or the mussels to produce the pearls for slice bodies of the small slices, can obtain the seawater pearls having colorful effects, can improve survival rate and pearl obtaining rate of the pearly shellfish and production rate of high quality pearls through synergistic action of appropriate operation steps and parameters, and is simple in operation process and convenient to use widely.

The invention provides a method for producing Pinctada martensii meat antihypertensive functional nutrient solution. The method comprises the following steps: after Pinctada martensii meat is boiled with water, the meat is dehydrated and smashed into pulp; the pulp is added to liquid carbon dioxide according to volume to carry out supercritical extraction to remove fishy smell; the pulp is stirred uniformly with water according to the weight of the Pinctada martensii meat pulp; the pulp is quickly heated up and boiled to inactivate enzyme after alkali protease is added for enzymolysis, and is quickly heated up and boiled to inactive enzyme after trypsin is added for enzymolysis; aqueous solution is centrifugally collected, and is filtered by a reverse osmosis membrane; and filtrate is collected and concentrated in vacuum, and is diluted by deionized water to be appropriate, and a proper amount of cane sugar is added to the filtrate to prepare the product. The method can produce the antihypertensive functional nutrient solution in batch by using the Pinctada martensii meat which is leftovers in pearl manufacture serving as a main raw material, and the product has pure taste, simple process, short production period, large output, low cost, high economic benefit and obvious antihypertensive effect.

The invention discloses an optimized hatching breeding method for pinctada martensii seedlings. The method comprises the following steps of collection of parent pinctada martensiis, preparation beforeinsemination, parturition hastening through induction, insemination, hatching, trochophore collection and temporary breeding, larva breeding, prevention and treatment for insects and diseases, seedling adhering and seedling collection. According to the method, wild original strains are collected as the parent pinctada martensiis, by adjusting the seawater PH value and salt degree of breeding liquid, a good environment suitable for propagation of pinctada martensiis is created, and in the insemination process, the scientific proportion of ova to sperms is adopted; egg cells which are not subjected to insemination, excess sperm cells and remaining tissue cells are timely removed, the hatching water quality of the pinctada martensiis is effectively improved, the ovum washing time of the pinctada martensiis is shortened, the hatching density of oosperms is increased, and therefore the hatching rate is increased. The hatched and bred pinctada martensii seedlings are strong, the variety isgood, the breeding survival rate is high, the method is easy to implement, and the economic benefits are high.

The invention discloses a Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) genes and application of the Pif promoter. The nucleotide sequence of the Pif promoter is shown as SEQ ID NO.1. A Pif promoter sequence is obtained through amplification by a genome walking method. The Pif promoter has a binding site 1 and a binding site 2, which can be bound to the MSX genes. Through the establishment of wild type carriers and mutant type carriers of Pif promoters of different fragment lengths, a dual-luciferase reporter gene system is applied to identify the fact that the MSX genes act on the Pif promoter through the binding site 1. The Pif promoter can start the downstream target gene expression, thereby promoting the growth of pearls or pearl oysters.

The invention discloses a cultivation method for increasing the yield of pinctada martensii pearl particles. The method comprises the following steps: preparing a 50-100 microns pearl layer powder byutilizing shell nacre; selecting 1.0-1.5 age individuals as donor shellfish for preparing a mantle minor septum; carrying out enzymolysis on the mantle minor septum by utilizing trypsin to obtain cytochylema; adding the pearl layer powder into the cytochylema to prepare a mixed liquid and injecting the mixed liquid into connective tissues near the top of receptor shell through a mantle cavity; after 6 months of cultivation, carrying out second-time injection; then carrying out 12 months of cultivation and harvesting pearls. By adopting the method, the yield of the pearl particles can be increased, and good economic and social benefits are produced.

The invention relates to aquatic feeds, and particularly discloses pinctada martensii micro-encapsulated diet and a preparation method thereof. The pinctada martensii micro-encapsulated diet is prepared from core raw materials and wall raw materials, wherein the core raw materials comprise the following components in percentage by weight: 10-15 percent of fish powder, 5-15 percent of enzyme hydrolyzed soybean meal, 40-60 percent of kelp powder, 5-10 percent of yeast autolytic powder, 5-15 percent of spirulina powder, 10-20 percent of alpha-starch, 1-2 percent of compound minerals, 0.3-0.6 percent of vitamin complex and 0.1-0.3 percent of choline. According to the preparation method, the core raw materials and the wall raw materials are grinded and mixed to prepare the micro-encapsulated diet by utilizing a spray-drying method. The micro-encapsulated diet is fully-artificial feed for feeding habits and nutritional requirement of pinctada martensii, and is used for providing raw material guarantee for establishing large-scale industrial aquaculture and pearl production mode of pinctada martensii.

The invention discloses preparation of an imprinted crosslinked chitosan resin and application thereof in removal of cadmium from pinctada martensii homogenate. The imprinted crosslinked chitosan resin is prepared by the following steps of: preparing a cadmium-citric acid compound; reacting chitosan with the cadmium-citric acid compound to obtain the chitosan resin of the cadmium-citric acid compound, and reacting the chitosan resin and glutaraldehyde to obtain the crosslinked resin of the cadmium-citric acid compound and the chitosan; and soaking and eluting the cadmium-citric acid compound with hydrochloric acid to obtain the cadmium-citric acid molecule imprinted crosslinked chitosan resin. After shells of pinctada martensii are opened, meat is taken out from the shells and the meat is homogenized, the cadmium is extracted from the pinctada martensii homogenate by citric acid complexing; the cadmium-citric acid compound in the extracting solution is absorbed by the imprinted crosslinked chitosan resin; and the cadmium is separated from the meat homogenate through centrifugal filtration and then is removed. Influence on the original nutrient component in the meat homogenate is little. The imprinted crosslinked chitosan resin has the advantages of simple and convenient production method, easily controlled operation process, reproducibility and reutilization, removal rate of the cadmium in the pinctada martensii meat homogenate of 86.15 to 91.23 percent and preservation rate of amino nitrogen of over 95.62 percent.

The invention discloses an establishment method of a Pinctada martensii MSAP (methylation sensitive amplification polymorphism) technical system, which comprises the following steps: (1) extracting Pinctada martensii genome DNA (deoxyribonucleic acid); (2) performing double digestion on the genome DNA, and connecting with a primer linker; (3) establishing a pre-amplification reaction system and a reaction procedure; (4) establishing a selective amplification reaction system and a reaction procedure; and (5) performing denaturing polyacrylamide gel electrophoresis and silver staining color development. The establishment method of a Pinctada martensii MSAP technical system can provide an analysis foundation for DNA methylation genetic mechanism research of Pinctada martensii, DNA methylation regulation and control of gene expression and DNA methylation variation caused by external environment variation. The invention is suitable for germplasm analysis and identification of Pinctada martensii, development of DNA methylation molecular markers and correlation analysis of gene expression and DNA methylation.

The invention relates to a pallium cell tablet treating fluid used in Pinctada martensii pearl breeding. The treating fluid comprises 20-30g of calcium propionate, 0.02-0.05g of doxycyline and 1000mL of distilled water. The preparation method comprises the following steps: successively and completely dissolving 20-30g of calcium propionate and 0.02-0.05g of doxycyline in distilled water and evenly stirring so as to obtain the pallium cell tablet treating fluid used in Pinctada martensii pearl breeding. By adopting the treating fluid to treat the pallium cell tablet, the surgery bacteria infection can be effectively inhibited, the wound healing is promoted, and the survival rate, nucleus remaining rate and pearl quality of pearl-breeding Pinctada martensii are effectively improved.

The invention provides a postoperative recuperation method for pinctada martensii. The technical scheme is characterized in that pinctada martensii subjected to nucleus insertion firstly rest in an indoor cement pit for 7-10 d, antibacterial agents are applied for preventing pinctada martensii against infections and death so that survival rate of pinctada martensii subjected to nucleus insertion is increased; pinctada martensii are moved to an outdoor pond for rest so that the workload for manual cultivation of monodus subterraneus during indoor rest is greatly reduced; and meanwhile, the water for rest in the calm pond is good for decrease in opening-closing frequencies of shells so that the remained nucleus ratio is improved.

The invention discloses a quality-guaranteed fresh keeping processing method of pinctada martensii meat, and belongs to the technical field of processing of marine products. The quality-guaranteed fresh keeping processing method of pinctada martensii meat comprises the working procedures of performing soaking and cleaning in seawater, removing surface mucosa, performing fishy smell removal treatment, performing sterilization treatment, performing precooling treatment, performing soaking treatment in quality-guaranteed fresh keeping liquid, performing vacuum packing and the like. The quality-guaranteed fresh keeping processing method of pinctada martensii meat provided by the invention can perform quality-guaranteed fresh keeping processing on the pinctada martensii meat, people in inland remote districts can taste the primary taste of the pinctada martensii meat, nutrients and moisture can be guaranteed not to flow out, at the premise that mouth feel is guaranteed, storage time can beprolonged, the haul distance can be enlarged, the supply cycle of seafood can be prolonged, and the transport cost can be saved. In the processing treatment course, the quality-guaranteed fresh keeping processing method is free from any materials harmful to human bodies, and the eating safety of the pinctada martensii meat can be guaranteed.

The invention discloses a staged low-specific-gravity mariculture method for pinctada martensii pearl culturing shellfish. The method comprises the steps as follows: selecting a culture pond, treating the culture pond, culturing the pearl culturing shellfish, harvesting pearls and the like, and the method specifically comprises the following steps: cleaning the pearl culturing shellfish which is cultured for 7-8 months in a sea area and is 3-4 months before pearl harvesting, and transferring the pearl culturing shellfish to the culture pond for hanging culture. The specific gravity of seawater in a culture water body is reduced, rapid growth and reproduction of unicellular algae in the water body are promoted through low-specific-gravity seawater, sufficient bait supply is provided for growth of the pinctada martensii, growth of the pinctada martensii is promoted, and the nacre secretion speed of the pinctada martensii is increased so as to increase the thickness of a nacre layer; and the pinctada martensii pearls produced with the culture method have large pearl layer thickness, the economic benefits of pinctada martensii pearl culture can be increased, and the staged low-specific-gravity mariculture method for the pinctada martensii pearl culturing shellfish is easily popularized and applied in pearl production enterprises and farmers and has remarkable social benefits and economic benefits.