SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof

A technology of SNP411871, Pinctada martensii, applied in the direction of recombinant DNA technology, biochemical equipment and methods, microbial determination/inspection, etc. weakening, etc.

Active Publication Date: 2015-06-17
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of the reasons, apart from the deteriorating breeding environment and backward breeding technology, there is another important reason: no attention has been paid to the selection and preservation of seed oysters for many years, and there is a lack of good varieties; , such as slow growth, small size, weakened pearl breeding ability, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof
  • SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof
  • SNP411871 marker associated to shell mould and weight of pinctada martensii, primer and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Randomly take 96 Pinctada martensii individuals from the same group, after cleaning, measure the shell size (shell height, shell length, shell width and hinge line length) with an electronic digital caliper, and weigh it with an electronic balance The weight of the soft body and the adductor muscle tissue were taken, and recorded one by one, and then a small piece of adductor muscle tissue was taken respectively, placed in 95% ethanol, and stored at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA from the adductor muscle of 96 Pinctada martensii individuals. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.

[0026] The detection primers for the SNP411871 marker associated with the shell type and we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a SNP411871 marker associated to shell mould and weight of pinctada martensii, a primer and an application thereof. The primer comprises 411871FI: GGAAACGGAATTCACATTCATTATCTTTA; 411871RI: AATGTCAAGCTGGATATAATTTAGCTCTA; 411871FO: AAATTATTGAAACTATTTCACCGATTCG; and 411871RO: TTGTGATTTCATTTTCGTATCAATATTCTT. According to the invention, a specific SNP genotype site can be amplified by the primer, size of individual shell length and hinge line length as well as weight of soft part and adductor muscle can be visually compared according to a PCR electrophoretogram, nd the primer can be directly used for subsequent molecular mark assisted breeding.

Description

Technical field: [0001] The invention belongs to the technical field of aquatic animal genetics and molecular marker assisted breeding, and specifically relates to a SNP411871 marker associated with the shell shape and weight of Pinctada martensii, as well as primers and applications. Background technique: [0002] Pinctada martensii is the main species of pearl culture in my country and the world. Since the successful artificial breeding of Pinctada martensii in my country in 1965, the seawater pearl industry has developed rapidly and has become one of the pillar industries of mariculture in Guangdong, Guangxi and some coastal areas of Hainan. In the past 10 years, the quality and output of seawater pearls in my country have declined significantly, the international competitiveness has weakened, and the economic benefits of breeding have declined. In terms of the reasons, apart from the deteriorating breeding environment and backward breeding technology, there is another i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 何毛贤李耀国
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap