Pif promoter capable of being activated by pinctada martensii MSX (muscle segment homeobox) gene and application thereof
A technology of Pinctada martensii and promoter, applied in the field of Pif promoter
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1: MSX activates the promoter of the pearl shell formation gene Pif
[0017] (1), Cloning and analysis of Pif promoter
[0018] Extract the genomic DNA of Pinctada martensii, design specific primer 1 (5′-TTGTGTCGGTGTCAAATCTG-3′) and nested primer 2 (5′-GCAAGTTCCATCTATTCGAGTTG-3′) according to the existing Pif gene sequence, and follow the genome walking kit (purchased from Clontech, USA) instructions to amplify the Pif promoter sequence. The 20 μl reaction system is: 8 μl of water, 10 μl of 2×PrimerSTAR enzyme premix (purchased from TaKaRa Japan), 0.5 μl of upstream and downstream primers, and 1 μl of template. The specific PCR reaction program was denaturation at 94°C for 15s; renaturation at 55°C for 15s; extension at 72°C for 2min; a total of 33 cycles. After the amplified product is sequenced, use the TRANSFAC website to predict the binding site and core sequence. The nucleotide sequence of the Pif promoter is shown in SEQ ID NO.1, with a full length of 13...
Embodiment 2
[0027] Example 2: After MSX is inhibited, the expression of Pif and the change of the structure of the pearl shell are identified to regulate the process of shell biomineralization
[0028] There were three groups: MSX dsRNA injection group, negative control GFP dsRNA injection group and blank control PBS injection group. Five second-year-old Pinctada martensii were injected into each group. Primer MSXF was designed according to the MSX gene sequence: GCGTAATACGACTCACTATAGGGAGA TTCATGGATCTCCAAAGACAAT and MSXR: GCGTAATACGACTCACTATAGGGAGA ATGGTGATACGTCATACCTACG, design primer GFPF according to GFP gene sequence: GCGTAATACGACTCACTATAGGGAGA ATGGTGAGCAAGGGCGAGGAG and GFPR: GCGTAATACGACTCACTATAGGGAGA TTACTTGTACAGCTCGTCCATG. Underlined is the T7 promoter sequence. Use pCDNA3.1-MSX expression vector as template, MSXF / MSXR as primers, amplify 648bp MSX fragment; use pEGFP-C1 (purchased from Clontech, USA) as template, GFPF / GFPR as primers, amplify 718bp GFP fragment . Using ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 