Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

41 results about "Myostatin Gene" patented technology

RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)

This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and / or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes.
Owner:SIRNA THERAPEUTICS INC

Method for knocking off animal myostatin gene by using CRISPR-Cas9 system

The invention provides a method for knocking off an animal myostatin gene by using a CRISPR-Cas9 system. The method comprises the following steps: firstly, acquiring a DNA sequence aiming at an sgRNA recognition area of a second myostatin exon, wherein the base sequence of the DNA sequence is as shown in SEQ ID NO.1; secondly, establishing an sgRNA expression structure of the second myostatin exon, inserting a T7 starter before an sgRNA transcriptional start site, establishing an in-vitro transcription carrier of Cas9 protein, and regulating and controlling by using the T7 starter. Cas9 mRNA and sgRNA are obtained through the in-vitro transcription carrier of Cas9 and sgRNA, and the method can be used for knocking off the animal myostatin gene.
Owner:CHINA AGRI UNIV

RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)

This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and / or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes.
Owner:BEIGELMAN LEONID +1

RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and / or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes.
Owner:SIRNA THERAPEUTICS INC

Directional modification method of specific gene of animal genome and application thereof

ActiveCN102653756AInefficient cutting mutagenesisHydrolasesMicrobiological testing/measurementZinc finger nucleaseEmbryo
The invention relates to a method for modifying an animal genome by directed mutagenesis, in particular relates to a novel directional transformation method of a specific gene of an animal genome by utilizing zinc finger nuclease. The method comprises the following steps: designing the zinc finger nuclease which specifically identifies and cuts a targeting gene according to a sequence in a target animal target gene region; validating the directional cutting capability and efficiency of the zinc finger nuclease to the target gene by using an independent expression system; and carrying out directional genetic modification on the target gene of the embryo of a target animal to obtain a stable genetic character by utilizing the selected zinc finger nuclease. Furthermore, the invention also relates to a main gene mutation mode which is obtained by using the independent expression system, selecting and utilizing the zinc finger nuclease, and a filial generation obtained through efficient screening and oriented genetic modification by utilizing the selected gene mutation mode. On the other hand, the invention relates to the zinc finger nuclease which is obtained by utilizing the method and is capable of specifically identifying the myostatin gene of pelteobagrus fulvidraco and directionally knocking out the myostatin gene of the pelteobagrus fulvidraco.
Owner:NANJING UNIV

Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Preparation method for myostatin knock-out pig

The invention discloses a preparation method for a myostatin knock-out pig, belonging to the technical field of biology. The preparation method is as follows: generating virus particles capable of expressing shRNA of myostatin gene of a targeted pig in a 293Ft cell; then infecting the fibroblasts of a piglet by using the produced slow virus; wherein after 48 hours, the expression of Myostatin genes in the fibroblasts is inhibited by fluorescence quantitative polymerase chain reaction (PCR) detection. In the invention, the slow virus particles can be used for carrying out microinjection on perivitelline space of a fertilized egg of the pig, can lead the virus nucleic acid to be integrated to an embryo gene group so as to express the shRNA, and can produce a transgenic pig with the myostatin of being knocked out after embryo transplantation. The slow virus particles also can be used for producing the transgenic pig by using a sperm vector method. By utilizing the preparation method, the cumbersome operation of knocking out the homologous targeting gene in the traditional method can be avoided, the virus consumption is less and the stable passage can be achieved.
Owner:NANJING AGRICULTURAL UNIVERSITY

Porcine myostatin gene editing site and application thereof

The invention discloses a porcine myostatin gene editing site and application thereof, and belongs to the fields of biotechnology and biomedical medicine engineering. A gene editing target site is separated from a porcine myostatin gene editing area, the sequence of the gene editing target site is 5'-GGCTGTGTAATGCATGTATGTGG-3', and the gene editing target site is located at a first exon of an MSTN (myostatin) coding area. The site can be recognized by Cas9 endonuclease specifically, so that double strands are medicated to break, homologous recombination between the double strands and shooting carriers is achieved, and mutant genes or selectable maker genes are integrated to a pre-positioned site of a recipient cell genome. A statistical result shows that shooting efficiency of the site is 80.5%. The porcine myostatin gene editing site has the advantages that an effective drone is provided to accurate porcine myostatin gene editing, a new strategy is provided to development of new species of live pigs with high lean meat percentage, and reliable measures and materials are provided to study on molecular mechanism and signal channel of myostatin.
Owner:INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI

Polypeptide pair for specifically recognizing muscle myostatin gene as well as encoding gene and application of gene

The invention discloses a polypeptide pair for specifically recognizing a muscle myostatin gene as well as an encoding gene and an application of the gene. The polypeptide pair provided by the invention comprises a polypeptide I and a polypeptide II; double-chain amino acid in the polypeptide I sequentially comprises 2-3, 36-37, 70-71, 104-105, 138-139, 172-173, 206-207, 240-241, 274-275, 308-309, 342-343, 376-377, 410-411, 444-445, 478-479 and 512-513 of the sequence 3; and double-chain amino acid in the polypeptide II sequentially comprises 2-3, 36-37, 70-71, 104-105, 138-139, 172-173, 206-207, 240-241, 274-275, 308-309, 342-343, 376-377, 410-411, 444-445, 478-479, 512-513 and 546-547 of the sequence 5. The polypeptide pair provided by the invention can specifically recognize the muscle myostatin gene, and has important application value in obtaining high-quality pig breeds with high lean meat percentage by knockout or modification of MSTN on pigs.
Owner:南宁壮博生物科技有限公司

RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)

This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and / or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes.
Owner:BEIGELMAN LEONID +1

Detection of two novel single nucleotide polymorphism (SNP) sites of promoter region of sheep myostatin (MSTN) gene and establishment of detection method thereof

The invention discloses the detection of two novel single nucleotide polymorphism (SNP) sites of a promoter region of a sheep myostatin (MSTN) gene, and the establishment of a detection method thereof. The method comprises the following steps of: 1, determining two mononucleotide mutational sites of the promoter region of the sheep myostatin gene, wherein the two mononucleotide mutational sites are positioned in a GeneBank sequence, the registry number is DQ530260, and the SNP sites (-959T / C, -784G / A) are positioned at -959th site and -784th site according to an initial codon ATG and comprise 6 genotypes (TT, TC, CC, GG, GA, AA); 2, detecting three specific primers of the mutant allele, wherein the lengths of the three specific primers are 22bp, 22bp and 21bp respectively, the first primer is used for the sequencing of the promoter region of the MSTN gene, and the second and third primers are bonded onto template strands of two mutant alleles respectively and are amplified to target genes obtained by the mutation of the alleles; and 3, performing polymerase chain reaction (PCR) amplification on genomic deoxyribonucleic acid (DNA) of a sample by a designed oligonucleotide primer, performing enzyme digestion analysis on products which are amplified to 985bp and 121bp fragments by utilizing Psp1406I and Rsa I restriction enzymes, and establishing a PCR-RFLP detection system of the SNP sites so as to obtain the polymorphism of the two mononucleotide mutational sites.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Pig muscle myostatin gene editing site 864-883 and application thereof

The invention discloses a pig muscle myostatin gene editing site 864-883 in a pig genome and application thereof, and belongs to the field of biological engineering. One gene editing target site is separated out from a pig muscle myostatin gene region; the sequence of the target site is 5'-GGATTTTGAAGCTTTTGGATGGG-3'; the site is positioned at a No.3 exon of an MSTN (myostatin) editing region. The site can be specifically identified by Cas9 endonuclease, so that mediated double chains fracture and then generate homologous recombination with targeting vectors; mutant genes or selectable maker gene and the like are integrated to the preset sites of a recipient cell genome. Statistical results show that the site targeting efficiency is 86.7 percent. The pig muscle myostatin gene editing site provided by the invention has the advantages that the effective target is provided for the precise embedding of the gene; new strategies are provided for developing live pig new varieties with high meat factor; reliable means and materials can be provided for developing myostatin molecular mechanisms and signal channels.
Owner:INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI

Method for rapidly detecting third exon single base mutation of myostatin gene

The invention provides a method for rapidly detecting the third exon single nucleotide polymorphism (SNP) of a beef myostatin gene. In the method, aiming at the G-to-A mutation of a third exon of the myostatin gene, two groups of PCR primer pairs for respectively amplifying an upstream sequence and a downstream sequence of a G938A single base polymorphism site are designed, wherein the primer pairs are respectively provided with a mismatched primer for mutation site, and the 3' tail end of the primer is positioned on the mutation site. By utilizing the primers, different beef DNA samples can obtain different amplification results, thereby judging the polymorphism of the third exon of the myostatin gene. The method has low cost, and simple, rapid and accurate operation, is suitable for popularization and application, and is important to rapidly and accurately carry out marker-assisted selection of beef, accelerate the beef selecting and breeding process and research a rapid PCR detecting method of the field of molecular biology.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

siRNA capable of restraining chicken myostatin gene expression and application thereof

The invention discloses a siRNA capable of restraining chicken myostatin (MSTN) gene expression and application of the siRNA; small interfering RNA (ribonucleic acid) acted on myostatin gene is provided by the invention and is a) or b) or c) as follows: a) double-stranded RNA composed of a sequence 1 of a sequence table and a sequence 2 of the sequence table; b) double-stranded RNA composed of a sequence 3 and a sequence 4 of the sequence table; and c) double-stranded RNA composed of a sequence 5 and a sequence 6 of the sequence table; according to the invention, the small interfering RNA effectively capable of restraining chicken MSTN gene expression is obtained and is proved to effectively reduce expression of MSTN through real-time fluorescent quantitative PCR (polymerase chain reaction) on molecular biology; chicks with obviously enlarged skeletal muscle is successfully acquired through a micro-injection test on embryology; above-mentioned results show that the small interfering RNA provided by the invention can be used for breeding the chicks, so that chicken yield of the chicks specifically high-quality chicks is increased.
Owner:CHINA AGRI UNIV

SYSTEMIC DELIVERY OF MYOSTATIN SHORT INTERFERING NUCLEIC ACIDS (siNA) CONJUGATED TO A LIPOPHILIC MOIETY

The present invention provides methods comprising the in vivo delivery of small nucleic acid molecules capable of mediating RNA interference and reducing the expression of myostatin, wherein the small nucleic acid molecules are introduced to a subject by systemic administration. Specifically, the invention relates to methods comprising the in vivo delivery of short interfering nucleic acid (siNA) molecules that target a myostatin gene expressed by a subject, wherein the siNA molecule is conjugated to a lipophilic moiety, such as cholesterol. The myostatin siNA conjugates that are delivered as per the methods disclosed are useful to modulate the in vivo expression of myostatin, increase muscle mass and / or enhance muscle performance. Use of the disclosed methods is further indicated for treating musculoskeletal diseases or disorders and / or diseases or disorders that result in conditions in which muscle is adversely affected.
Owner:SIRNA THERAPEUTICS INC

Pig myostatin gene promoter and its applications

A pig myostatin gene promoter and its applications are disclosed in the present invention. The DNA fragment provided in the present invention which is derived from pigs is anyone of the following DNA molecules 1)-4): 1) the DNA molecule of SEQ ID NO:2 shown in the Sequence Listing; 2) the DNA molecule of SEQ ID NO:3 shown in the Sequence Listing; 3) the DNA molecule which hybridizes to the DNA sequence in 1) or 2) under strict conditions and has promoter function; 4) the DNA molecule which has more than 90% homology with the DNA sequence in 1) or 2) and has promoter function. The experiments in the present invention prove that the promoter provided in the present invention can drive the expression of firefly luciferase reporter gene. The promoter can also be built into the reporter vector and then the vector is transfected into cultured swine and human cells, and the activity and efficiency of the promoter are identified by accurate quantitative methods through reporter gene test.
Owner:INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI

Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety

The present invention provides methods comprising the in vivo delivery of small nucleic acid molecules capable of mediating RNA interference and reducing the expression of myostatin, wherein the small nucleic acid molecules are introduced to a subject by systemic administration. Specifically, the invention relates to methods comprising the in vivo delivery of short interfering nucleic acid (siNA) molecules that target a myostatin gene expressed by a subject, wherein the siNA molecule is conjugated to a lipophilic moiety, such as cholesterol. The myostatin siNA conjugates that are delivered as per the methods disclosed are useful to modulate the in vivo expression of myostatin, increase muscle mass and / or enhance muscle performance. Use of the disclosed methods is further indicated for treating musculoskeletal diseases or disorders and / or diseases or disorders that result in conditions in which muscle is adversely affected.
Owner:SIRNA THERAPEUTICS INC

Method for deleting sheep Myostatin gene locus by zinc finger nuclease

ActiveCN103290045AAchieve the purpose of knockoutReduce the pressure of survivalArtificial cell constructsVertebrate cellsExonBiology
The invention discloses a method for deleting sheep Myostatin gene locus by zinc finger nuclease, and the method comprises the following steps: designing a sequence which targets a sheep Myostatin gene exon 3 and can recognize a specific target site of 39bp, constructing a zinc finger nuclease plasmid, transfecting a sheep fibroblast by the plasmid, obtaining a monoclonal cell with deleted diallele with 95bp and 113bp. The invention demonstrates that the method can accurately delete Myostatin gene exon 3 and separate cells whose Myostatin gene locus is deleted, thereby confirming the effectiveness of the sequence, and the obtained monoclonal cell with deletion is not need to be screened by antibiotic. The invention has two advantages of genome targeting modification and safety, and has important meanings for cultivating transgenic sheep without resistance marker genes and with safety and high efficiency.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Therapeutic vaccine for Myostatin specific antibody and its preparation method

The invention discloses a curative vaccine for Myostatin specific antibody and the method for preparing the same. The human myostatin C-end gene section that is connected with Th cell auxiliary epitope TT830-844 at N-end is prepared by using artificial DNA synthesizing method. The genetic sequence is TT-Ms, and the TT-Ms genetic section is cloned to pQE30 pronucleus expression carrier to construct pQE-TT-Ms recombinant expression carrier, and constructs pQE-Ms recombinant expression carrier by PCR augmenting Ms genetic section. The fused protein His-TT-Ms and His-Ms is expressed in bacillus coli, and is used as protein vaccine for myostatin after certification. The synthesized TT-Ms genetic section is cloned to specific plasmid of pVAC1-cms gene vaccine, and constructs pVAC-TT-Ms recombinant plasmid, and it is used as myostatin gene vaccine after external certification for target protein expression. The constructed Myostatin protein vaccine and gene vaccine is used in healthy adult BALB / c mouse, the specific antibody of myostatin molecule for human can be induced, and the quality and force of skeletal muscles of mouse is obviously improved.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Molecular marker for identifying duck slaughter traits based on myostatin gene MSTN and identification method and application thereof

The invention discloses a molecular marker for identifying duck slaughter traits based on a myostatin gene MSTN as well as an identification method and application of the molecular marker. The molecular marker is T or C, the molecular marker is located at the 458th site of a myostatin gene MSTN, and the myostatin gene MSTN has a nucleotide sequence as shown in SEQ ID NO. 1. The duck slaughter traits are selected according to genotypes by utilizing the polymorphism of the 458th basic group on the CDS sequence exon1 of the MSTN gene. The method for selecting the slaughter traits of the ducks has the advantages of early selection, time saving, simple operation, cost saving, high accuracy and the like.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Method for knocking out bovine myostatin gene by using zinc finger nuclease

The invention provides a method for knocking out a bovine myostatin gene by using zinc finger nuclease. The method comprises the following steps of: designing a ZFNs specific site expression vector according to a bovine myostatin gene sequence and transferring into bovine fibroblasts to obtain cells in which the myostatin gene is knocked out. The one-time transfection can be realized by utilizingZFNs-mediated gene knockout so as to obtain cell clone in which a diallele is knocked out, which is difficult to realize in the conventional gene targeting process; therefore, the medicine screening process is saved, the formation of cell monoclone is facilitated, the process that cells are required to resist the poisoning of medicines is avoided, key effects are achieved on the subsequent somatic cell nuclear transplantation and the development quality of embryos, resistance genes are not contained at the same time, and the biological safety evaluation process is greatly simplified.
Owner:BEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY

Constructing method of goat Myostatin gene knockout carrier

The invention discloses a constructing method of a goat Myostatin gene knockout carrier. In the method, according to sheep Myostatin gene sequence, two pairs of PCR (Polymerase Chain Reaction) primers are designed, genome DNA (Deoxyribonucleic Acid) extracted from goat fetus fibroblast is used as a template, amplification is carried out by adopting high-fidelity long-fragment Taq enzyme and a Long-PCR method to obtain homologous arms, wherein the homologous long and short arms are 4.6kb and 1.9kb, respectively. In order to verify whether the sequence of the obtained homologous arms can be used or not, the amplified fragments are respectively cloned to a pMD18-T carrier, and sequencing and homology comparison are carried out after enzyme digestion and PCR identification; and then the homologous long and short arms are respectively cloned to a carrier pLOXP and then identified by enzyme digestion and RCR method, and screening is carried out to obtain a MNST gene targeting carrier pLOXP-MSTN containing neo and HSV-tk positive-negative screening marker genes. According to the invention, the Myostatin gene knockout carrier is constructed by the Long-PCR method, and goat fetus fibroblast is transfected to obtain gene knockout cells; and by adopting the technique, animals with high lean meat percentage can be obtained, and a MNST gene knockout goat model is constructed, so that the method has important significance in further researching the function of the gene in goat.
Owner:ANHUI AGRICULTURAL UNIVERSITY

Method for knocking out sheep myostatin gene by zinc finger nuclease

ActiveCN103290045BAchieve the purpose of knockoutReduce the pressure of survivalArtificial cell constructsVertebrate cellsExonBiology
The invention discloses a method for deleting sheep Myostatin gene locus by zinc finger nuclease, and the method comprises the following steps: designing a sequence which targets a sheep Myostatin gene exon 3 and can recognize a specific target site of 39bp, constructing a zinc finger nuclease plasmid, transfecting a sheep fibroblast by the plasmid, obtaining a monoclonal cell with deleted diallele with 95bp and 113bp. The invention demonstrates that the method can accurately delete Myostatin gene exon 3 and separate cells whose Myostatin gene locus is deleted, thereby confirming the effectiveness of the sequence, and the obtained monoclonal cell with deletion is not need to be screened by antibiotic. The invention has two advantages of genome targeting modification and safety, and has important meanings for cultivating transgenic sheep without resistance marker genes and with safety and high efficiency.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Pig myostatin gene promoter and its applications

ActiveCN102725408BReliable genetic resourcesValuable Gene ResourcesBacteriaGenetic material ingredientsHuman cellCultured cell
A pig myostatin gene promoter and its applications are disclosed in the present invention. The DNA fragment provided in the present invention which is derived from pigs is anyone of the following DNA molecules 1)-4): 1) the DNA molecule of SEQ ID NO:2 shown in the Sequence Listing; 2) the DNA molecule of SEQ ID NO:3 shown in the Sequence Listing; 3) the DNA molecule which hybridizes to the DNA sequence in 1) or 2) under strict conditions and has promoter function; 4) the DNA molecule which has more than 90% homology with the DNA sequence in 1) or 2) and has promoter function. The experiments in the present invention prove that the promoter provided in the present invention can drive the expression of firefly luciferase reporter gene. The promoter can also be built into the reporter vector and then the vector is transfected into cultured swine and human cells, and the activity and efficiency of the promoter are identified by accurate quantitative methods through reporter gene test.
Owner:INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI

A method for efficiently creating mstn gene mutants of Yellow River catfish

The invention belongs to the field of fish genetics and breeding, and specifically discloses a method for efficiently creating mstn gene mutants of Yellow River catfish. This method is aimed at the Yellow River catfish MyostatinMyostatin Gene Design Target Site, Synthetic gRNA, and Cas9 Proteins were co-microinjected into mature eggs of Yellow River catfish (stage V eggs), and then dry insemination was performed with yellow catfish sperm. After hatching and emergence, the mutation efficiency was tested. The knockout efficiency was 80%, and the average mutation efficiency was 74.1%. And the proportion of fully mutant individuals was 24%. Compared with the traditional fish gene editing method, this method not only obtains higher mutation efficiency, but also can efficiently obtain complete mutant individuals of Yellow River catfish, and the combination of gynogenesis increases the homozygosity of mutant individuals. For economic fish with a long reproductive cycle The rapid directional molecular design breeding of species also has important reference value.
Owner:INST OF AQUATIC LIFE ACAD SINICA

Therapeutic vaccine for Myostatin specific antibody and its preparation method

The invention discloses a curative vaccine for Myostatin specific antibody and the method for preparing the same. The human myostatin C-end gene section that is connected with Th cell auxiliary epitope TT830-844 at N-end is prepared by using artificial DNA synthesizing method. The genetic sequence is TT-Ms, and the TT-Ms genetic section is cloned to pQE30 pronucleus expression carrier to constructpQE-TT-Ms recombinant expression carrier, and constructs pQE-Ms recombinant expression carrier by PCR augmenting Ms genetic section. The fused protein His-TT-Ms and His-Ms is expressed in bacillus coli, and is used as protein vaccine for myostatin after certification. The synthesized TT-Ms genetic section is cloned to specific plasmid of pVAC1-cms gene vaccine, and constructs pVAC-TT-Ms recombinant plasmid, and it is used as myostatin gene vaccine after external certification for target protein expression. The constructed Myostatin protein vaccine and gene vaccine is used in healthy adult BALB / c mouse, the specific antibody of myostatin molecule for human can be induced, and the quality and force of skeletal muscles of mouse is obviously improved.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Polypeptide pair for specifically recognizing muscle myostatin gene as well as encoding gene and application of gene

The invention discloses a polypeptide pair for specifically recognizing a muscle myostatin gene as well as an encoding gene and an application of the gene. The polypeptide pair provided by the invention comprises a polypeptide I and a polypeptide II; double-chain amino acid in the polypeptide I sequentially comprises 2-3, 36-37, 70-71, 104-105, 138-139, 172-173, 206-207, 240-241, 274-275, 308-309, 342-343, 376-377, 410-411, 444-445, 478-479 and 512-513 of the sequence 3; and double-chain amino acid in the polypeptide II sequentially comprises 2-3, 36-37, 70-71, 104-105, 138-139, 172-173, 206-207, 240-241, 274-275, 308-309, 342-343, 376-377, 410-411, 444-445, 478-479, 512-513 and 546-547 of the sequence 5. The polypeptide pair provided by the invention can specifically recognize the muscle myostatin gene, and has important application value in obtaining high-quality pig breeds with high lean meat percentage by knockout or modification of MSTN on pigs.
Owner:南宁壮博生物科技有限公司

Skeletal muscle specific miRNA expression vector and reconstitution cell of target Myostatin gene

The invention discloses a skeletal muscle specific miRNA expression vector and a reconstitution cell of target Myostatin gene. Transgenic cloned embryos are prepared by the following steps: firstly constructing a skeletal muscle specific miRNA expression vector pmiR-MNM2 containing pre-miRNA and MYL1 gene promoters of the target Myostatin gene; then guiding the exogenous expression vector pmiR-MNM2 into red Augus neonatal bovine fibroblasts by an electric dye-transfer method, obtaining positive cells through G418 screening, and performing PCR (Polymerase Chain Reaction) identification to verify that the target gene is integrated into the genome of bovine embryonic fibroblasts; transferring bovine embryonic fibroblasts subjected to pmiR-MNM2 dye transfer, which are taken as donor cells, into bovine enucleated oocytes to finally obtain the transgenic cloned embryos which are transplanted into wombs of acceptor cows. The invention lays a solid foundation for production of red Augus cloned cattle with a dual-muscle characteristic.
Owner:NORTHWEST A & F UNIV +1

siRNA capable of restraining chicken myostatin gene expression and application thereof

The invention discloses a siRNA capable of restraining chicken myostatin (MSTN) gene expression and application of the siRNA; small interfering RNA (ribonucleic acid) acted on myostatin gene is provided by the invention and is a) or b) or c) as follows: a) double-stranded RNA composed of a sequence 1 of a sequence table and a sequence 2 of the sequence table; b) double-stranded RNA composed of a sequence 3 and a sequence 4 of the sequence table; and c) double-stranded RNA composed of a sequence 5 and a sequence 6 of the sequence table; according to the invention, the small interfering RNA effectively capable of restraining chicken MSTN gene expression is obtained and is proved to effectively reduce expression of MSTN through real-time fluorescent quantitative PCR (polymerase chain reaction) on molecular biology; chicks with obviously enlarged skeletal muscle is successfully acquired through a micro-injection test on embryology; above-mentioned results show that the small interfering RNA provided by the invention can be used for breeding the chicks, so that chicken yield of the chicks specifically high-quality chicks is increased.
Owner:CHINA AGRI UNIV

A method for directional modification of specific genes in animal genomes and its application

ActiveCN102653756BInefficient cutting mutagenesisHydrolasesMicrobiological testing/measurementBiotechnologyGenes mutation
The invention relates to a method for modifying an animal genome by directed mutagenesis, in particular relates to a novel directional transformation method of a specific gene of an animal genome by utilizing zinc finger nuclease. The method comprises the following steps: designing the zinc finger nuclease which specifically identifies and cuts a targeting gene according to a sequence in a target animal target gene region; validating the directional cutting capability and efficiency of the zinc finger nuclease to the target gene by using an independent expression system; and carrying out directional genetic modification on the target gene of the embryo of a target animal to obtain a stable genetic character by utilizing the selected zinc finger nuclease. Furthermore, the invention also relates to a main gene mutation mode which is obtained by using the independent expression system, selecting and utilizing the zinc finger nuclease, and a filial generation obtained through efficient screening and oriented genetic modification by utilizing the selected gene mutation mode. On the other hand, the invention relates to the zinc finger nuclease which is obtained by utilizing the method and is capable of specifically identifying the myostatin gene of pelteobagrus fulvidraco and directionally knocking out the myostatin gene of the pelteobagrus fulvidraco.
Owner:NANJING UNIV