39 results about "Myostatin Gene" patented technology

The invention relates to a method for modifying an animal genome by directed mutagenesis, in particular relates to a novel directional transformation method of a specific gene of an animal genome by utilizing zinc finger nuclease. The method comprises the following steps: designing the zinc finger nuclease which specifically identifies and cuts a targeting gene according to a sequence in a target animal target gene region; validating the directional cutting capability and efficiency of the zinc finger nuclease to the target gene by using an independent expression system; and carrying out directional genetic modification on the target gene of the embryo of a target animal to obtain a stable genetic character by utilizing the selected zinc finger nuclease. Furthermore, the invention also relates to a main gene mutation mode which is obtained by using the independent expression system, selecting and utilizing the zinc finger nuclease, and a filial generation obtained through efficient screening and oriented genetic modification by utilizing the selected gene mutation mode. On the other hand, the invention relates to the zinc finger nuclease which is obtained by utilizing the method and is capable of specifically identifying the myostatin gene of pelteobagrus fulvidraco and directionally knocking out the myostatin gene of the pelteobagrus fulvidraco.

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.

The invention discloses a preparation method for a myostatin knock-out pig, belonging to the technical field of biology. The preparation method is as follows: generating virus particles capable of expressing shRNA of myostatin gene of a targeted pig in a 293Ft cell; then infecting the fibroblasts of a piglet by using the produced slow virus; wherein after 48 hours, the expression of Myostatin genes in the fibroblasts is inhibited by fluorescence quantitative polymerase chain reaction (PCR) detection. In the invention, the slow virus particles can be used for carrying out microinjection on perivitelline space of a fertilized egg of the pig, can lead the virus nucleic acid to be integrated to an embryo gene group so as to express the shRNA, and can produce a transgenic pig with the myostatin of being knocked out after embryo transplantation. The slow virus particles also can be used for producing the transgenic pig by using a sperm vector method. By utilizing the preparation method, the cumbersome operation of knocking out the homologous targeting gene in the traditional method can be avoided, the virus consumption is less and the stable passage can be achieved.

The invention discloses the detection of two novel single nucleotide polymorphism (SNP) sites of a promoter region of a sheep myostatin (MSTN) gene, and the establishment of a detection method thereof. The method comprises the following steps of: 1, determining two mononucleotide mutational sites of the promoter region of the sheep myostatin gene, wherein the two mononucleotide mutational sites are positioned in a GeneBank sequence, the registry number is DQ530260, and the SNP sites (-959T/C, -784G/A) are positioned at -959th site and -784th site according to an initial codon ATG and comprise 6 genotypes (TT, TC, CC, GG, GA, AA); 2, detecting three specific primers of the mutant allele, wherein the lengths of the three specific primers are 22bp, 22bp and 21bp respectively, the first primer is used for the sequencing of the promoter region of the MSTN gene, and the second and third primers are bonded onto template strands of two mutant alleles respectively and are amplified to target genes obtained by the mutation of the alleles; and 3, performing polymerase chain reaction (PCR) amplification on genomic deoxyribonucleic acid (DNA) of a sample by a designed oligonucleotide primer, performing enzyme digestion analysis on products which are amplified to 985bp and 121bp fragments by utilizing Psp1406I and Rsa I restriction enzymes, and establishing a PCR-RFLP detection system of the SNP sites so as to obtain the polymorphism of the two mononucleotide mutational sites.

The invention discloses a pig muscle myostatin gene editing site 864-883 in a pig genome and application thereof, and belongs to the field of biological engineering. One gene editing target site is separated out from a pig muscle myostatin gene region; the sequence of the target site is 5'-GGATTTTGAAGCTTTTGGATGGG-3'; the site is positioned at a No.3 exon of an MSTN (myostatin) editing region. The site can be specifically identified by Cas9 endonuclease, so that mediated double chains fracture and then generate homologous recombination with targeting vectors; mutant genes or selectable maker gene and the like are integrated to the preset sites of a recipient cell genome. Statistical results show that the site targeting efficiency is 86.7 percent. The pig muscle myostatin gene editing site provided by the invention has the advantages that the effective target is provided for the precise embedding of the gene; new strategies are provided for developing live pig new varieties with high meat factor; reliable means and materials can be provided for developing myostatin molecular mechanisms and signal channels.

The invention provides a method for rapidly detecting the third exon single nucleotide polymorphism (SNP) of a beef myostatin gene. In the method, aiming at the G-to-A mutation of a third exon of the myostatin gene, two groups of PCR primer pairs for respectively amplifying an upstream sequence and a downstream sequence of a G938A single base polymorphism site are designed, wherein the primer pairs are respectively provided with a mismatched primer for mutation site, and the 3' tail end of the primer is positioned on the mutation site. By utilizing the primers, different beef DNA samples can obtain different amplification results, thereby judging the polymorphism of the third exon of the myostatin gene. The method has low cost, and simple, rapid and accurate operation, is suitable for popularization and application, and is important to rapidly and accurately carry out marker-assisted selection of beef, accelerate the beef selecting and breeding process and research a rapid PCR detecting method of the field of molecular biology.

The invention discloses a siRNA capable of restraining chicken myostatin (MSTN) gene expression and application of the siRNA; small interfering RNA (ribonucleic acid) acted on myostatin gene is provided by the invention and is a) or b) or c) as follows: a) double-stranded RNA composed of a sequence 1 of a sequence table and a sequence 2 of the sequence table; b) double-stranded RNA composed of a sequence 3 and a sequence 4 of the sequence table; and c) double-stranded RNA composed of a sequence 5 and a sequence 6 of the sequence table; according to the invention, the small interfering RNA effectively capable of restraining chicken MSTN gene expression is obtained and is proved to effectively reduce expression of MSTN through real-time fluorescent quantitative PCR (polymerase chain reaction) on molecular biology; chicks with obviously enlarged skeletal muscle is successfully acquired through a micro-injection test on embryology; above-mentioned results show that the small interfering RNA provided by the invention can be used for breeding the chicks, so that chicken yield of the chicks specifically high-quality chicks is increased.

The present invention provides methods comprising the in vivo delivery of small nucleic acid molecules capable of mediating RNA interference and reducing the expression of myostatin, wherein the small nucleic acid molecules are introduced to a subject by systemic administration. Specifically, the invention relates to methods comprising the in vivo delivery of short interfering nucleic acid (siNA) molecules that target a myostatin gene expressed by a subject, wherein the siNA molecule is conjugated to a lipophilic moiety, such as cholesterol. The myostatin siNA conjugates that are delivered as per the methods disclosed are useful to modulate the in vivo expression of myostatin, increase muscle mass and/or enhance muscle performance. Use of the disclosed methods is further indicated for treating musculoskeletal diseases or disorders and/or diseases or disorders that result in conditions in which muscle is adversely affected.

A pig myostatin gene promoter and its applications are disclosed in the present invention. The DNA fragment provided in the present invention which is derived from pigs is anyone of the following DNA molecules 1)-4): 1) the DNA molecule of SEQ ID NO:2 shown in the Sequence Listing; 2) the DNA molecule of SEQ ID NO:3 shown in the Sequence Listing; 3) the DNA molecule which hybridizes to the DNA sequence in 1) or 2) under strict conditions and has promoter function; 4) the DNA molecule which has more than 90% homology with the DNA sequence in 1) or 2) and has promoter function. The experiments in the present invention prove that the promoter provided in the present invention can drive the expression of firefly luciferase reporter gene. The promoter can also be built into the reporter vector and then the vector is transfected into cultured swine and human cells, and the activity and efficiency of the promoter are identified by accurate quantitative methods through reporter gene test.

The invention discloses a method for deleting sheep Myostatin gene locus by zinc finger nuclease, and the method comprises the following steps: designing a sequence which targets a sheep Myostatin gene exon 3 and can recognize a specific target site of 39bp, constructing a zinc finger nuclease plasmid, transfecting a sheep fibroblast by the plasmid, obtaining a monoclonal cell with deleted diallele with 95bp and 113bp. The invention demonstrates that the method can accurately delete Myostatin gene exon 3 and separate cells whose Myostatin gene locus is deleted, thereby confirming the effectiveness of the sequence, and the obtained monoclonal cell with deletion is not need to be screened by antibiotic. The invention has two advantages of genome targeting modification and safety, and has important meanings for cultivating transgenic sheep without resistance marker genes and with safety and high efficiency.

The invention discloses a curative vaccine for Myostatin specific antibody and the method for preparing the same. The human myostatin C-end gene section that is connected with Th cell auxiliary epitope TT830-844 at N-end is prepared by using artificial DNA synthesizing method. The genetic sequence is TT-Ms, and the TT-Ms genetic section is cloned to pQE30 pronucleus expression carrier to construct pQE-TT-Ms recombinant expression carrier, and constructs pQE-Ms recombinant expression carrier by PCR augmenting Ms genetic section. The fused protein His-TT-Ms and His-Ms is expressed in bacillus coli, and is used as protein vaccine for myostatin after certification. The synthesized TT-Ms genetic section is cloned to specific plasmid of pVAC1-cms gene vaccine, and constructs pVAC-TT-Ms recombinant plasmid, and it is used as myostatin gene vaccine after external certification for target protein expression. The constructed Myostatin protein vaccine and gene vaccine is used in healthy adult BALB/c mouse, the specific antibody of myostatin molecule for human can be induced, and the quality and force of skeletal muscles of mouse is obviously improved.