SNP298299 marker significantly correlated with pinctada martensii mollusc part weight and adductor muscle weight, as well as primers and application of SNP298299 marker
A technology of 298299RI and 298299FI, which is applied in the field of aquatic animal genetics and molecular marker-assisted breeding, can solve the problems of the degeneration of the broodstock, the deterioration of the breeding environment, and the slow growth.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Randomly take 96 Pinctada martensii individuals from the same group. After cleaning, take their soft parts and weigh them, then take their adductor muscle tissues and weigh them and record them one by one. Take a small piece of adductor muscle Tissues were stored in 95% ethanol at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA from the adductor muscle of 96 Pinctada martensii individuals. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.
[0026] The detection primers for the SNP298299 marker associated with the soft body weight and adductor muscle weight of Pinctada martensii are:
[0027] 298299FI:GGAATTCGTATCACTGTTTGAAGCAAGG;
[0028] 298299RI:GGGAACACATCCCACATTTAACAATGTTA;
[0029] 298299FO:...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 