1341 results about "Polymerase chain reaction" patented technology

The invention discloses a tryptophan synthase mutant as well as a coding gene, a vector, recombinant bacteria and application thereof. Comprising the following steps: carrying out error-prone PCR (Polymerase Chain Reaction) on a coding gene trpBA of TrpS from EscherichiaoliK12MG1655, screening mutants by combining high-throughput screening, and finding that the affinity of the TrpS to a substrate indole can be effectively improved by mutating 114-site Gln of a beta subunit of the TrpS into Met and mutating 84-site Gly into Ser, so that the synthesis of L-tryptophan is promoted. The efficiency of the TrpS for converting indole and L-serine into L-tryptophan is higher due to the improvement of the affinity of indole. A new idea is provided for efficient production of L-tryptophan in the fermentation industry.

The invention discloses a primer pair and a method for identifying a new Oudemansiella oosporoides strain HCS, and belongs to the technical field of specific molecular markers, the preservation number of the new Oudemansiella oosporoides strain HCS is CGMCC NO.41593, and the sequences of the primer pair Y6-F1 / Y6-R2 are as shown in SEQ ID NO.2 and SEQ ID NO.3. The specific method comprises the following steps: extracting DNA of an Oudemansiella oosporoides strain to be detected; carrying out PCR (Polymerase Chain Reaction) amplification by taking the extracted DNA of the sample to be detected as an amplification template and a molecular specific labeled primer consisting of the sequence shown by the primer as an amplification primer; and carrying out agarose gel electrophoresis detection on the PCR product. The primer pair has the advantages that the primer pair can be used for quickly identifying the strain HCS, the operation is simple and convenient, the specificity is strong, the accuracy is high, and a technical basis is provided for protecting a new variety of the strain HCS.

The invention discloses a molecular marker closely linked with a wheat powdery mildew resistance gene PmL424. The molecular marker is YTU024-L10; the nucleotide sequence of an upstream primer of the molecular marker is as shown in SEQ ID NO: 1; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; a marker primer of the molecular marker YTU024-L10 is used for carrying out PCR (Polymerase Chain Reaction) amplification on wheat genome DNA (Deoxyribose Nucleic Acid) to be detected to obtain a corresponding amplification product with the molecular weight of 238 bp, namely the molecular marker closely linked with the wheat powdery mildew resistance gene PmL424. The molecular marker provided by the invention can more accurately and efficiently detect a genetic mapping population of PmL424, and map-based cloning and fine positioning of PmL424 are facilitated; and secondly, the marker is used for molecular marker-assisted selection of PmL424, so that the wheat breeding cycle can be shortened, and the breeding efficiency can be improved.

The invention discloses a primer group and a kit for simultaneously detecting nucleic acids of various respiratory pathogens based on twenty-six PCR (Polymerase Chain Reaction). The kit comprises primer pool freeze-dried powder of influenza A virus (FluA), influenza B virus (FluB), respiratory syncytial virus (RSV), human parainfluenza virus (hPIV), mycoplasma pneumoniae (MP), novel coronavirus (SARS-CoV-2), human respiratory adenovirus (HADV), human respiratory nose / enterovirus (HRV / HEV), bordetella pertussis (BP), human coronavirus (HCoV), human bocavirus (HBoV) and chlamydia pneumoniae (CP), PCR (polymerase chain reaction) freeze-dried powder and a buffer solution. According to the kit, primer system optimization is carried out on various pathogens, brand new primers and probe pools are designed, clinical sensitivity and specificity can be achieved, and meanwhile, the kit is matched with a fully-closed full-automatic detection card box integrating sample treatment and amplification and is suitable for rapid detection of respiratory tract pathogens.

The invention belongs to the technical field of molecular biology, and particularly relates to a nucleic acid sequence combination for simultaneously detecting various pathogenic vibrios, an RT-PCR (reverse transcription-polymerase chain reaction) kit and a use method of the RT-PCR kit, and the nucleic acid sequence combination is shown as SEQ ID No.1-SEQ ID No.19. The RT-PCR kit comprises RT-PCR primer probes, the primer probes comprise forward and reverse amplification primers and detection probes respectively aiming at vibrio cholerae, vibrio parahaemolyticus, vibrio fluvialis, vibrio mimicus, vibrio vulnificus and vibrio alginolyticus, and corresponding sequences in SEQ ID No.1-SEQ ID No.19 are adopted. The kit disclosed by the invention can be used for rapidly detecting and identifying the six vibrios at the same time; the kit has high accuracy, specificity and sensitivity, and is suitable for clinical detection of infected samples.

The invention belongs to the technical field of plant virus detection, and provides a multiplex RT-PCR detection method for areca-nut related viruses. The primer group for multiple RT-PCR detection of areca-related viruses (areca yellow virus APV1, areca ringspot virus ANRSV and areca shuttle spot virus ANSSV) comprises a first primer group for detecting the APV1, a second primer group for detecting the ANRSV and a third primer group for detecting the ANSSV. The invention also provides a detection kit, which comprises a PCR reaction solution, and the PCR reaction solution comprises the primer group. The invention also provides application of the kit in simultaneous detection of areca-related viruses APV1, ANRSV and ANSSV. The primer group and the kit disclosed by the invention can specifically detect three areca-nut related viruses in a PCR system, can accurately identify any combination infection of the three viruses, and have the characteristics of high efficiency, economy, simplicity and convenience.

The invention relates to a primer and probe combination for nested PCR detection of urinary tract klebsiella pneumoniae and drug-resistant genes and a kit thereof, and primer and probe sequences designed in the invention do not cause cross amplification of other urinary tract pathogenic bacteria, and can meet specific requirements. In addition, exogenous antibiotic interferents such as gentamicin, tobramycin, ceftazidime, levofloxacin, piperacillin and nitrofurantoin have no influence on experimental results, and the anti-interference requirement is met. The prepared kit can be used for simultaneously detecting the urinary tract klebsiella pneumoniae and the drug-resistant gene, and the detection is convenient, simple and reliable. Compared with common strain identification, drug resistance gene detection can guide clinical medication more accurately, and invalid treatment is avoided.

The invention discloses a verification method for regulating and controlling proliferation and differentiation of bovine adipocytes by gene interference, which comprises the following steps: cutting bovine adipocyte tissues into small blocks, directly pasting the small blocks in a culture dish for culture, and promoting cell growth and proliferation by using nutrition and growth factors of the tissues; a ZNF423 gene is targeted by adopting an siRNA technology, siRNA is transfected into bovine fat cells by utilizing a transfection reagent, and the siRNA is an interference fragment containing si-ZNF423; the method comprises the following steps: respectively extracting total RNA (Ribonucleic Acid) and total protein of bovine adipocytes, and detecting by utilizing qPCR (Quantitative Polymerase Chain Reaction) quantitative analysis, a WB (White Batch) technology, EdU dyeing, flow cytometry detection, oil red O, BODIPY (Boron Dipyrromethene), Nile Red dyeing, TG (Triglyceride) content determination and the like. According to the invention, ZNF423 gene expression is interfered by the interference fragment containing si-ZNF423, and the effect of inhibiting proliferation and differentiation of bovine adipocytes is detected by various methods, so that the effect of the interference fragment in the bovine adipocytes is known conveniently, and regulation and control of proliferation and differentiation of the bovine adipocytes are realized by interfering gene expression by the interference fragment. The beef quality can be improved; the beef cattle breeding can be optimized.

The invention discloses a photo-thermal amplification and real-time PCR (polymerase chain reaction) detection integrated optical fiber system, and relates to the field of pathogen testing, the optical fiber system comprises an optical fiber probe, a photo-thermal photosensitizer and a micro reaction chamber; the micro-reaction chamber is used for extracting and discharging a to-be-detected sample by utilizing air pressure, the optical fiber probe is arranged in the micro-reaction chamber, and the optical fiber probe reacts with the to-be-detected sample in the micro-reaction chamber; the photo-thermal photosensitizer is arranged inside or on the outer surface of the optical fiber probe and is used for receiving heat generated by the heating light to heat the optical fiber probe and controlling the reaction temperature of the optical fiber probe and the to-be-detected sample; the optical fiber probe is also used for receiving the exciting light which excites the to-be-detected sample to generate a fluorescence signal, and the optical fiber probe is used for detecting the fluorescence signal. According to the application, sample collection, photo-thermal cycle amplification and real-time fluorescent quantitative detection can be integrated, and rapid and effective detection of a virus sample is realized.

The invention discloses application of iron ruthenium nano-enzyme in preparation of nucleic acid detection products, and belongs to the technical field of biological detection and nano-materials. The RIN has stable peroxidase-like (POD) activity, and can catalyze a chromogenic reaction between 3, 3 ', 5, 5'-tetramethyl benzidine (TMB) and hydrogen peroxide (H2O2). The catalytic activity of the nano-enzyme can be selectively inhibited by pyrophosphate (PPi) generated in a nucleic acid amplification reaction, so that visual colorimetric analysis on whether target nucleic acid exists or not is realized. In combination with a polymerase chain reaction (PCR) system, the invention constructs a new nucleic acid detection strategy which does not need fluorescence labeling, is simple and convenient to operate and has high sensitivity. Through verification, the system can be widely applied to rapid on-site screening and visual interpretation of related nucleic acid of drug-resistant pathogens (such as ESKAPE flora) and the like, and has a good application prospect.

The present invention relates to a method and a composition for identifying phages. The method comprises the steps of: - providing a phage composition comprising at least two different phages, each of whose genetic code is known at least in part, - incubating a bacterial sample with the phage composition, - adjusting and maintaining the bacterial sample incubated with the phage composition under conditions in which a phage can use a bacterium as a host cell, - performing a quantitative polymerase chain reaction using primer pairs, each specific for a phage, and - identifying the phage(s) whose reproduction is favored by the presence of a host cell suitable for these phages in the bacterial sample. The invention further relates to a method for quantifying phages in a sample.

The invention belongs to the technical field of animal molecular marker screening and application. In particular to an SSR molecular marker primer related to the meat percentage character of procambarus clarkii and application of the SSR molecular marker primer in auxiliary selection. The method comprises the following steps: performing correlation analysis on meat content related character phenotypes of two full-sib families, four natural populations and four rice-shrimp co-culture populations of procambarus clarkii by using SSR markers to perform PCR (Polymerase Chain Reaction) amplification on collected samples to obtain target fragments and using genotypes detected by polyacrylamide gel electrophoresis; and identifying a QTL (Quantitative Trait Loci) associated with the meat percentage character. By screening the dominant genotype of the SSR marker, the procambarus clarkii strain with high meat content is bred in an assisted manner. The molecular marker primer disclosed by the invention can be used for rapidly screening out a group with a high meat content character; the repeatability in different groups is high; meanwhile, the dominant genotype identified by the application corresponds to the high meat percentage character, and the effect is remarkable.

The invention belongs to the technical field of molecular identification of insects, and particularly relates to multiple PCR (Polymerase Chain Reaction) primers and a method for rapidly identifying thrips insect varieties. The invention discloses a multiple PCR primer and a method for rapidly identifying the variety of thrips, the identification primer and a multiple PCR system can rapidly, effectively and accurately identify the three types of thrips, and the sizes of PCR product strips of tobacco thrips, comb flower thrips and common large thrips are 104 bp, 237 bp and 439 bp respectively. The detection limit of the sensitive tobacco thrips is 500 copies, and the detection limits of the sensitive tobacco thrips and the sensitive common large thrips are both 100 copies. Compared with common PCR which can only identify one type of thrips at a time, the multiplex PCR system can complete identification of various types of thrips at a time, has the advantages of being easy to operate, low in cost, capable of saving time and the like, has very high value in the aspect of field thrips detection, and can be widely applied to the fields of plant protection and the like.

A method for obtaining from genomic material genomic copy number information unaffected by amplification distortion, comprising obtaining segments of the genomic material, tagging the segments with substantially unique tags to generate tagged nucleic acid molecules, such that each tagged nucleic acid molecule comprises one segment of the genomic material and a tag, subjecting the tagged nucleic acid molecules to polymerase chain reaction (PCR) amplification, generating tag associated sequence reads by sequencing the product of the PCR reaction, assigning each tagged nucleic acid molecule to a location on a genome associated with the genomic material by mapping the subsequence of each tag associated sequence read corresponding to a segment of the genomic material to a location on the genome, and counting the number of tagged nucleic acid molecules assigned to the same location on the genome having a different tag, thereby obtaining genomic copy number information unaffected by amplification distortion.

The utility model provides a PCR (Polymerase Chain Reaction) sealed detection box which comprises a PCR micro-fluidic chip main body and a chip supporting plate, the PCR micro-fluidic chip main body comprises a substrate and a cover plate which are attached to each other, at least one reaction chamber is formed on the substrate, and sample injection holes are respectively formed on the cover plate corresponding to the end parts of the reaction chambers; a plurality of chip bulges and an elastic limiting card are arranged on the second surface of the chip supporting plate, the chip bulges are used for limiting and fixing the PCR micro-fluidic chip main body, and the elastic limiting card is arranged on one side, different from the chip bulges, of the PCR micro-fluidic chip main body and is provided with an elastic structure in the horizontal or vertical direction; the fixing device is used for detachably loading, pressing and fixing a PCR micro-fluidic chip main body. According to the PCR sealed detection box provided by the utility model, sample adding and sealing of the PCR micro-fluidic chip are simplified and automatic, and the PCR sealed detection box is more suitable for being integrated into automatic PCR detection equipment.

The invention discloses a construction method and application of an NMD escape model of an Alport syndrome mouse. A non-human animal model carrying Col4a5 gene c.4432delG frame shift mutation is prepared on the basis of a CRISPR / Cas9 gene editing technology. The method comprises the following steps: co-injecting gRNA of a 49 exon of a targeted Col4a5 gene, homologous recombinant donor oligonucleotide containing c.4432delG mutation and Cas9 nuclease into a mouse fertilized egg, and carrying out embryo transplantation to obtain an F0-generation mutant mouse; a mutation site is verified by combining PCR (Polymerase Chain Reaction) with sequencing, and a stably inherited mutation line is established through two generations of breeding. Through verification, the model accords with pathological characteristics of the Alport syndrome, can stably simulate typical clinical manifestation and pathological characteristics of the human X-linked Alport syndrome, and can be used as an important tool for research of the Alport syndrome.

The invention provides a non-disease diagnosis purpose 5-hydroxymethylcytosine 5hmC detection method and a non-disease diagnosis purpose 5-hydroxymethylcytosine 5hmC detection kit. The detection method comprises the following steps: S1, glycosylation treatment; s2, carrying out enzyme digestion treatment on the GSREs; s3, carrying out APOBEC deamination treatment; s4, carrying out hydroxymethylation detection; the kit comprises a glycosylation reaction kit, a GSREs enzyme digestion reaction kit, an APOBEC deamination reaction kit and a PCR (Polymerase Chain Reaction) kit. The glycosylation reaction kit comprises a CutSmart buffer solution, UDP-Glucose, a T4-BGT enzyme and nuclease-free water, wherein the CutSmart buffer solution, the UDP-Glucose and the T4-BGT enzyme are used as raw materials; the GSREs enzyme digestion reaction kit comprises a GSREs enzyme, an enzyme digestion reaction buffer solution and nuclease-free water, the APOBEC deamination reaction kit comprises APOBEC, BSA (Bovine Serum Albumin), an APOBEC Reactive buffer solution and nuclease-free water; the PCR kit comprises a PCR reaction solution, a primer and a probe. According to the 5-hydroxymethylcytosine 5hmC detection method and kit for non-disease diagnosis purpose provided by the invention, precise quantification of extremely high specificity of 5hmC is realized, and the detection sensitivity is also improved while the specificity of a detection signal is improved.

The invention discloses a plasma tsRNA molecular marker for predicting postoperative delirium of old patients and application of the plasma tsRNA molecular marker, and is characterized in that the plasma tsRNA molecular marker is tRF-Gly-14 and / or tRF-Arg-39, the nucleotide sequence of the tRF-Gly-14 is AATGGTAGAATTTCGGCC, the nucleotide sequence of the tRF-Arg-39 is TCAGAAGATTGAGGGTTCGAATCCTTCGTGGTTG, and the nucleotide sequence of the tRF-Gly-14 and / or the tRF-Arg-39 is / are AATGGTAGAATTTCGGTGGTTG. The invention further provides application of the plasma tsRNA molecular marker in preparation of a kit for predicting postoperative delirium of old patients. The kit comprises forward and reverse primers for fluorescent quantitative PCR (Polymerase Chain Reaction) amplification of tRF-Gly-14 and / or tRF-Arg-39; the method has the advantages of high POD prediction accuracy, high sensitivity and strong specificity, and is helpful for identifying high-risk patients in time.

The invention belongs to the technical field of virus detection, and discloses a digital PCR (Polymerase Chain Reaction) kit for simultaneously detecting African horse pestivirus, West Nile virus and equine influenza H3N8, and the kit comprises primers and probes as shown in SEQ ID NO.1-SEQ ID NO.21. The invention also discloses a kit for simultaneously detecting African horse pestivirus, West Nile virus and equine influenza H3N8. According to the invention, after a single system of an African horse pestivirus VP7 gene, an African horse pestivirus-NS2 gene, a west nile virus-NS5 gene, a west nile virus-NS2a gene, an equine influenza H3N8-HA gene and an equine influenza H3N8-NA gene is tested, a seven-fold digital PCR (Polymerase Chain Reaction) system containing an internal standard is established; through tests of indexes such as linearity, specificity, minimum detection limit, repeatability, comparison of a single digital PCR system and a multiple digital PCR system, the currently developed digital PCR multiple detection kit completely meets development requirements and is high in specificity and sensitivity, and the minimum detection limit of the digital PCR multiple detection kit can reach 10 Copies / mu L or below.

The invention relates to the technical field of plant genetic engineering, in particular to a genetic transformation method of prunus mume line plum blossom leaf calluses. The method comprises the following steps: firstly preparing a plum blossom genetic transformation receptor, then transforming agrobacterium tumefaciens by taking an RUBY gene as a reporter gene to prepare an infection bacterium solution, then carrying out callus infection and co-culture, and finally screening to obtain the resistant callus. According to the method provided by the invention, the resistant callus can be identified in an observation or PCR (Polymerase Chain Reaction) detection mode. The plum blossom callus is successfully infected, the red callus expressed by the RUBY reporter gene is obtained, the inductivity is high, and a good basis is provided for establishment and genetic improvement of a plum blossom genetic system.

The invention discloses a chitinase mutant obtained based on random mutation as well as a preparation method and application of the chitinase mutant. On the basis of an error-prone PCR (Polymerase Chain Reaction) technology, the mutant ChiA-7 (T165I / C253Y / A391T / N480S / T508S / K547T / I550V / N607T) of the chitinase ChiA of the bacillus thuringiensis is obtained by the invention. Compared with ChiA, the ChiA-7 has better stability, and the enzyme activity of the ChiA-7 is about 90% of the initial enzyme activity after the ChiA-7 is subjected to heat preservation for 3 hours at 40 DEG C in a phosphate buffer solution with the optimal catalysis condition of 40 DEG C and the pH value of 4.0, while the enzyme activity of the ChiA-7 is attenuated to 75% of the initial enzyme activity. The chiA-7 is connected with a carrier pET20b (+) and is transferred into escherichia coli Escherichia coli BL21 (DE3), and the extracellular enzyme activity of a recombinant bacterium reaches 10.23 U / mL, which is improved by 13.41% compared with the enzyme activity of a control bacterium for expressing chiA. The chitinase mutant obtained by the preparation method disclosed by the invention has good thermal stability and enzymatic activity, and can be applied to hydrolysis of chitin and inhibition of mould.

The invention discloses a correction method of PCR (Polymerase Chain Reaction) preference, a DNA (Deoxyribose Nucleic Acid) artificially synthesized sequence combination of a TCR-beta immune repertoire, a primer combination for amplifying the TCR-beta immune repertoire, a quantitative analysis method of the TCR-beta immune repertoire of a gDNA sample, a detection kit and application of the detection kit. The PCR preference correction method can effectively correct the preference generated in the PCR amplification process, the DNA artificially synthesized sequence combination can effectively adjust the primer concentration ratio of the multiple PCR primer combination, and the primer combination can efficiently and quantitatively amplify a TCR-beta immune repertoire without mutual interference as much as possible. According to the method, the immune repertoire can be accurately and quantitatively analyzed at the DNA level.

The invention relates to the technical field of plant germplasm resources. The invention provides an SSR-PCR (Simple Sequence Repeat-Polymerase Chain Reaction) primer group for a robinia pseudoacacia genome SSR molecular marker, a robinia pseudoacacia core germplasm fingerprint spectrum obtained by utilizing the primer group and a method for constructing a robinia pseudoacacia core germplasm bank. The SSR-PCR primer group disclosed by the invention is relatively high in polymorphism, good in stability, relatively good in expression in the operation of the SSR molecular marker of the robinia pseudoacacia germplasm genome, and good in screening effect. By adopting the construction method disclosed by the invention, excellent germplasm with special characters can be screened out to construct the fingerprint spectrum of the robinia pseudoacacia core germplasm, a basis is better provided for scientific management, efficient utilization and preservation of robinia pseudoacacia germplasm resources, and meanwhile, the breeding efficiency can be effectively improved.

The present disclosure provides compositions, apparatus and methods for conducting separate sequencing batches on a support having nucleic acid template molecules immobilized thereon, where the separate sequencing batches can be conducted using any massively parallel sequencing technology. In some embodiments, a plurality of sub-populations of nucleic acid template molecules are immobilized to the support including at least a first and second sub-population. In some embodiments, the first sub-population of template molecules undergo first batch sequencing reactions and a region of the support is imaged to detect the first sequencing reactions, wherein the second sub-population of template molecules do not undergo sequencing reactions. In some embodiments, the second sub-population of template molecules undergo second batch sequencing and the same region of the support is imaged to detect the second sequencing reactions, wherein the first sub-population of template molecules do not undergo sequencing reactions.

The invention provides a diagnostic marker for systemic lupus erythematosus and application of the diagnostic marker, and belongs to the technical field of biological medicine. The diagnostic marker is at least one protein of PDGFA (Platelet Derivative Growth Factor Amplification), APOD (Adenosine Polymerase Chain Reaction), CFHR5, AMDHD1 and SCGB3A1; the amino acid sequence of the PDGFA is as shown in SED ID NO. 1; the amino acid sequence of the APOD is as shown in SED ID NO. 2; the amino acid sequence of the CFHR5 is as shown in SED ID NO.3; the amino acid sequence of AMDHD1 is as shown in SED ID NO. 4; and the amino acid sequence of the SCGB3A1 is as shown in SED ID (Sequence of Identification) NO.5. According to the present invention, the five proteins are adopted as the SLE disease diagnosis biomarker independently or in the combination manner, such that advantages of high accuracy, high sensitivity and high specificity are provided, and the new target spot is provided for the diagnosis, the intervention improvement and the like of the SLE patient.

The invention relates to a PCR (Polymerase Chain Reaction) kit and method for identifying brucella pathogens and application. The PCR kit comprises primer pairs and probes for simultaneously detecting brucella BA0711 vaccine strains, M5-9026 vaccine strains, Rev.1 vaccine strains and wild strains. A primer pair for detecting the brucella BA0711 vaccine strain is shown as SEQ ID NO.1-2, and a probe is shown as SEQ ID NO.3; a primer pair for detecting the M5-9026 vaccine strain is shown as SEQ ID NO.4-5, and a probe is shown as SEQ ID NO.6; a primer pair for detecting the Rev.1 vaccine strain is shown as SEQ ID NO.7-8, and a probe is shown as SEQ ID NO.9; a primer pair for detecting positive brucella is shown as SEQ ID NO.10-11, and a probe is shown as SEQ ID NO.12; the kit has the advantages of high sensitivity and strong specificity, and can simultaneously distinguish a plurality of vaccine strains and wild strains.

The invention discloses three SNP molecular markers yzrs329085302, rs320468838 and yzrs325631013 on a chromosome 14, the left nipple number, the right nipple number and the total nipple number of boars with different genotypes are remarkably different, the three new SNP molecular markers can be used for evaluating the nipple number of the boars for non-diagnosis and treatment purposes, and compared with the existing PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) and other methods, the three SNP molecular markers have the advantages that the number of the left nipples, the number of the right nipples and the number of the total nipples of the boars with different genotypes can be evaluated; the method has the outstanding advantages of being simple, rapid, high in sensitivity, good in specificity and the like.

The invention provides a multiple qPCR (quantitative polymerase chain reaction) primer probe group for detecting a duck tembusu virus, a duck reovirus, a duck hepatitis A virus type 1 and a duck hepatitis A virus type 3, a detection system and application, and belongs to the technical field of virus detection. The multiplex qPCR detection primer probe group comprises an upstream primer, a downstream primer and a fluorescent probe which are used for detecting the duck tembusu virus, the upstream primer, the downstream primer and the fluorescent probe are used for detecting the duck reovirus; the upstream primer, the downstream primer and the fluorescent probe are used for detecting the duck hepatitis A virus type 1, and the upstream primer, the downstream primer and the fluorescent probe are used for detecting the duck hepatitis A virus type 3. The primer probe group disclosed by the invention has good specificity and sensitivity and can be used for simultaneously detecting four waterfowl infectious disease pathogens.

The invention discloses an InDel molecular marker related to wheat yield traits and application of the InDel molecular marker, and belongs to the technical field of molecular genetics. The InDel molecular marker is a molecular marker InDel 509; the nucleotide sequence of the molecular marker InDel 509 is as shown in SEQ ID No. 1. A wheat TaPRR95-5A gene functional marker InDel 509 is used for carrying out PCR (Polymerase Chain Reaction) amplification, polyacrylamide gel electrophoresis detection is carried out, and a germplasm material carrying a Hap II type is screened out according to the size of a target band. The functional marker can provide an effective marker resource for wheat genetic improvement and molecular marker-assisted breeding.

The invention discloses an application of a rice OsRNU7 gene. The registration number of the nucleotide sequence of the OsRNU7 gene in Genbank is LOC4337677, and the registration number of the nucleotide sequence of the OsRNU7 gene is LOC4337677. RNA-seq is utilized to discover that the OsRNU7 shows response to the external nitrogen supply level, and fluorescent quantitative PCR (Polymerase Chain Reaction) proves that the OsRNU7 is induced by high nitrogen. The OsRNU7 is knocked out, so that the nitrogen absorption rate, the plant height and the yield of the rice are reduced, and the comprehensive performance is that the nitrogen fertilizer utilization efficiency is reduced. The function of the OsRNU7 gene for positively regulating the utilization efficiency of the rice nitrogen fertilizer is defined, and a technical route for improving the utilization efficiency of the rice nitrogen fertilizer by increasing the expression of the OsRNU7 in rice is provided.