Check patentability & draft patents in minutes with Patsnap Eureka AI!

Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer

A technology of Pinctada martensii and adductor muscle weight, which is applied in the direction of recombinant DNA technology, microbial measurement/inspection, biochemical equipment and methods, etc., and can solve the problems of lack of good varieties, uneven quality of seedlings, and breeding environment. Deterioration and other issues

Active Publication Date: 2014-10-15
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In terms of the reasons, apart from the deteriorating breeding environment and backward breeding technology, there is another important reason: no attention has been paid to the selection and preservation of seed oysters for many years, and there is a lack of good varieties; , such as slow growth, small size, weakened pearl breeding ability, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer
  • Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer
  • Detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of detection primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Randomly take 50 Pinctada martensii individuals from the same group, after cleaning, take the adductor muscle tissue and weigh it with an electronic balance and record one by one, and then take a small piece of adductor muscle tissue and put it in 95% in ethanol and stored at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA of the adductor muscle. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.

[0026] The detection primers for the SNP marker associated with adductor muscle weight of Pinctada martensii are:

[0027] ASSN815FI: TCCATCGTGGACAAACGTGTAA;

[0028] ASSN815RI:GTGTCAAAGTAAACTGTATCTCGTGCC;

[0029] ASSN815FO:TAGAATTGGCAAAGGAACAAGCAT;

[0030] ASSN815RO: AATAATTCCTAACAGGTGCCCGTC

[003...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection primer marked by SNP and associated with pinctada martensi adductor muscle weight and application of the detection primer. The detection primer comprises the following substances:ASSN815FI: TCCATCGTGGACAAACGTGTAA; ASSN815RI: GTGTCAAAGTAAACTGTATCTCGTGCC; ASSN815FO: TAGAATTGGCAAAGGAACAAGCAT; ASSN815RO: AATAATTCCTAACAGGTGCCCGTC. Through the adoption of the detection primer marked by SNP and associated with pinctada martensi adductor muscle weight, SNP sites of the myostatin genes can be amplified, and the SNP sites are associated with the muscle weight obviously; according to the PCR amplification electrophotogram, the size of the adductor muscle weight between individuals can be compared visually, so that the detection primer can be directly used for follow-up molecular marker assistant breeding, for example, the detection primer can be used for selecting target characters in early growth stage, and then the specific individual is selected for variety breed.

Description

Technical field: [0001] The invention belongs to the technical field of aquatic animal genetics and molecular marker assisted breeding, and specifically relates to a detection primer of a SNP marker associated with adductor muscle weight of Pinctada martensii and an application thereof. Background technique: [0002] Pinctada martensii is the main species of pearl culture in my country and the world. Since the successful artificial breeding of Pinctada martensii in my country in 1965, the seawater pearl industry has developed rapidly and has become one of the pillar industries of mariculture in Guangdong, Guangxi and some coastal areas of Hainan. In the past 10 years, the quality and output of seawater pearls in my country have declined significantly, the international competitiveness has weakened, and the economic benefits of breeding have declined. In terms of the reasons, apart from the deteriorating breeding environment and backward breeding technology, there is another...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 何毛贤李琴
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More