A kind of SNP marker detection primer associated with adductor muscle weight of Pinctada martensii and its application
A technology of Pinctada martensii and adductor muscle weight, applied in the direction of recombinant DNA technology, microbial measurement/testing, biochemical equipment and methods, etc., can solve the problem of uneven quality of seedlings and lack of emphasis on breeding of shellfish and retention, slow growth and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Randomly take 50 Pinctada martensii individuals from the same group, after cleaning, take the adductor muscle tissue and weigh it with an electronic balance and record it one by one, then take a small piece of adductor muscle tissue and put it in 95% in ethanol and stored at -20°C. HiPure Universal DNA Kit (Guangzhou Meiji Biological Co., Ltd.) was used to extract the genomic DNA of the adductor muscle. For related operations, refer to the kit instructions. After the DNA was extracted, its integrity was detected by electrophoresis on 1.0% agarose gel, and the concentration and purity of the DNA were measured by an ultraviolet spectrophotometer, and stored at -20°C.
[0026] The detection primers for the SNP marker associated with adductor muscle weight of Pinctada martensii are:
[0027] ASSN815FI: TCCATCGTGGACAAACGTGTAA;
[0028] ASSN815RI:GTGTCAAAGTAAACTGTATCTCGTGCC;
[0029] ASSN815FO:TAGAATTGGCAAAGGAACAAGCAT;
[0030] ASSN815RO: AATAATTCCTAACAGGTGCCCGTC
[0031...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
