Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Scheme and application for increasing amylose content of corn seeds through overexpression of Sh2 and Bt2 genes and RNAi suppression expression of SBEIIa and SBEIIb genes

A technology of amylose content and high amylose starch is applied in the field of bioengineering breeding of crops, and can solve the problems of not significantly increasing starch content and the like

Inactive Publication Date: 2010-07-07
SHANDONG UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, introduction of this gene in another potato variety did not significantly increase starch content (Sweetlove et al.1996)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1: Construction and selection of the RNAi structure of SBE IIa and SBE IIb genes

[0046] 1) Cloning of SBE IIa and SBE IIb gene fragments

[0047] The specific and conserved regions of corn starch branching enzyme genes SBE IIa and IIb were amplified by PCR method. According to the sequences of SBE IIa and IIb genes, primers for amplifying the specific regions and conserved regions of SBE IIa and IIb were designed. The primers used to amplify the specific fragment of the SBE IIb gene are: Special 5': 5'CGGTCGCTGGGGTTTTAG 3', and Special 3': 5'GAGCCGAGTCAGCCCTTG 3', each with a protective base at the 5' end of the primer The restriction endonuclease sites BamHI and NcoI. The primers used to amplify the specific fragment of SBE IIa gene are: special 5' long: 5'ACTTGCCGTCGGTGCTCT 3', and special 3' long: 5'CCAACATTGGGTCAATCTCAT 3'; special 5' short: 5'ATGACTTGCTTTCCTCCG 3', and special 3' 'Short: 5'TCCTCAGCCTCAACTCCT 3'; a restriction endonuclease site XhoI ...

Embodiment 2

[0057] Example 2: Construction of multigene (RNAi structure) transformation vector and creation of high-amylose high-yielding maize

[0058] 1) Cloning of large and small subunit genes Sh2 and Bt2 of maize endosperm AGPase

[0059] According to the nucleotide sequences of the large and small subunit genes Sh2 and Bt2 of maize endosperm-specific AGPase, using the constructed endosperm cDNA library, primers were designed and the full-length cDNA of the gene was amplified by PCR. The primer sequence used to amplify the full-length sequence of the Sh2 coding region is: 5' end primer 5' GCTCTAGAGC TCGGGAGGCAAGTGCGA TTT 3’, 3’ Primer 5’ GCTCTAGAGC GTCAAGCGGCTCTTACCATACCAA 3', the restriction endonuclease site XbaI (underlined) with protective bases is added at the 5' end of the primer. Sh2 full-length amplification was performed by gradient PCR with Pyrobest Taq enzyme, and the reaction conditions were: 95°C 5min; 95°C 1min, 57°C 1min (±4°C), 72°C 2min, 35 cycles; 72°C 7min. The ...

Embodiment 3

[0068] Example 3: Transformation of maize clustered bud tissue blocks to create high-amylose high-yield inbred lines and its application

[0069] 1) The establishment of the receptor system is based on the backbone inbred lines used in agricultural production in my country, such as the inbred seeds of Zheng 58, Ye 478, and Ye 515. Clustered buds were induced from the shoot tips in vitro, and the clustered buds were used as receptors for genetic transformation. The media used are:

[0070] Seed germination medium: KNO 3 1900mg / l, NH4NO 3 1650mg / l, CaCl 2 2H 2 O 440mg / l, MgSO 4 ·7H 2 O 370mg / l, KH 2 PO 4 ·H 2 O 170mg / l, FeSO 4 ·7H 2 O 27.8mg / l, ZnSO 4 ·7H 2 O 10mg / l, MnSO 4 4H 2 O 22.3 mg / l, H 3 BO 3 10mg / l, KI 0.83mg / l, Na 2 MoO 4 2H 2 O 0.5mg / l, CuSO 4 ·5H 2 O 0.025mg / l, CoCl 2 ·6H 2 O 0.025mg / l, Thiamine Hydrochloride 10.0mg / l, Pyridoxine Hydrochloride 1.0mg / l, Niacin 1.0mg / l, Glycine 2.0mg / l, Inositol 100.0mg / l, Biotin 0.05mg / l , casein hydrolyzat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a scheme and application for increasing the amylose content of corn seeds through the overexpression of Sh2 and Bt2 genes and the RNAi suppression expression of SBEIIa and SBEIIb genes. A method comprises the following steps of: respectively fusing the Sh2 and Bt2 genes cloned from corns in righteous forms with specific promoters of endosperms; then recombining to a plant expression vector, and guiding to corn cells by adopting a transgenic technology to obtain transgenic plants with enlarged seeds and high starch content; altering the SBEIIa and SBEIIb genes to the corns with a same genetype by RNAi structures promoted by the specific promoters of the endosperms, screening plants with high amylose, and creating new corn germplasm and species with high amylose and seed yield through the hybridization of the transgenic plants, or recombining the RNAi structures of the Sh2 and Bt2 genes and the SBEIIa and SBEIIb genes to the same plant expression vector to obtain the transgenic plants with high seed yield and amylase and descendants thereof through the transgenic technology.

Description

technical field [0001] The invention belongs to the field of bioengineering breeding of crops, and specifically relates to a scheme and an application for increasing corn grain amylose content through overexpression of sh2 and bt2 genes and RNAi inhibition of expression of sbe IIa and sbe IIb genes. Background technique [0002] Amylose is an important industrial raw material with a wide range of uses and involves various fields, such as food, medical, textile, paper, packaging, petroleum, environmental protection, optical fiber, high-level printed circuit boards and electronic chips and other industries; another potential value is Corn high amylose is the best raw material for the production of photolytic plastics, and the use of amylose to produce photolytic plastics is an effective way to solve the current serious "white pollution". However, the amylose content of common corn is between 22% and 28%, and the cost of extracting amylose from common corn is very high. At pre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H1/02
Inventor 张举仁李宁李坤朋李蓓杨爱芳张可炜
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com