17 results about "Ribonucleoside" patented technology

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.

This disclosure relates to 1H-pyrazolo[3,4-d]pyrimidine ribonucleoside compounds of Formula (I) and pharmaceutically acceptable salts thereof, which activate LACTB and are useful for treating diseases or disorders, such as cancer.

The invention discloses a method for rapidly detecting MTHFR (Methylene Tetrahydrofolate Reductase) gene polymorphism based on a complementary probe technology, which comprises the following steps: S1, acquiring a sample: extracting genome DNA (Deoxyribose Nucleic Acid) from a sample to be detected as an amplification template; s2, preparing a reaction system: adding the genome DNA, the upstream primer, the downstream primer, the C probe, the T probe, uracil-N-glycosylase, DNA polymerase, deoxyribonucleoside triphosphate and deoxyuridine triphosphate of the sample to be detected into the reaction system; s3, carrying out PCR (Polymerase Chain Reaction) amplification reaction under the conditions that the temperature is 90-98 DEG C, and the time is 5-20 minutes; performing denaturation at the temperature of 90-98 DEG C for 10-50 seconds; the temperature is 55-69 DEG C, and annealing is conducted for 60-120 s; the temperature is 68-72 DEG C, and extension is carried out for 15-300 s; carrying out 35 to 40 cycles; and S, genotype judgment. A test result is the same as a first-generation sequencing test result, which shows that the detection method of the scheme has relatively high accuracy. Meanwhile, compared with a sequencing method, the method has the advantages that a series of complex follow-up treatment does not need to be carried out on a PCR product, PCR amplification and detection are synchronously carried out, the detection time is greatly shortened, and the detection cost is reduced.

A method for transcribing a DNA template into RNA in vitro includes providing a mixture comprising a buffer material, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at from about 25 DEG C to about 40 DEG C for from about 1 hour to about 12 hours, thereby producing the RNA. In one embodiment, a method for in vitro transcription includes providing a DNA template and a cap analog that binds-1 and / or + 1 nucleotides of a promoter for in vitro transcription, thereby producing mRNA of more complete length, allowing for more flexible selection of a first mRNA base, and providing a + 2 position open to a custom sequence.

The invention discloses a nucleic acid detection product, a system containing the nucleic acid detection product, a kit and a method for detecting Zika virus. The system comprises Tris, potassium acetate, DTT, polyethylene glycol 20000, deoxyribonucleoside triphosphate (dNTP), adenosine triphosphate (ATP), phosphocreatine, creatine kinase, Bsu, gp32, uvs X, uvs Y, Superscript IV Reverse Transcriptase, a primer pair, LbCas12a, a crRNA sequence, RNase H and magnesium acetate, and an RPA / CRISPR one-pot reaction can be realized, and detection is carried out through an electrochemical method. The system or the kit containing the system can realize rapid diagnosis of the Zika virus in different scenes, is simple and convenient in operation method and low in cost, has relatively high sensitivity and specificity, and is suitable for being applied to airports, disease control units and other grassroots units.

The invention provides a kit for DNA ligation reaction as well as a use method and application thereof. The kit comprises a first component and a second component, wherein the first component comprises a positively charged substance and a first buffer solution; the positively charged substance is selected from at least one of positively charged polypeptide, positively charged protein, positively charged synthetic macromolecule and positively charged glucan; the second component comprises a negatively charged substance and a second buffer solution; the negatively charged substance is selected from at least one of adenosine triphosphate, deoxyribonucleoside triphosphate, oligonucleotide and negatively charged polypeptide. The first component and the second component are arranged in the kit, when the first component and the second component are prepared into a reaction system, a condensate emulsion of hundreds of nanometers to several micrometers can be formed in situ, the condensate emulsion can spontaneously enrich all the components required by the reaction, and an emulsion matrix phase is a gel-like environment; and the ligation reaction efficiency and accuracy can be remarkably improved through the crowding effect between macromolecules.

This application relates to the field of metabolic engineering and genetic engineering technology for production, specifically providing a uracil-producing strain, its construction method, and its application. This strain is... E. coli Knockout of the uridine kinase gene in the W3110 genome udk Simultaneously integrates the T7 RNA polymerase gene; weakens the uridine kinase gene. pyrH Overexpression of carbamoyl phosphate synthase gene carAB ribose-phosphokinase gene prsA pyrimidine-5'-nucleotide nuclease gene ppnN UMP phosphohydrolase gene umpH and umpG Ribonucleotide hydrolase 1 gene rihA and glutamine synthase gene glnA Heterogeneous introduction of wild-type Bacillus subtilis B. subtilis 168 orotate nucleoside monophosphate decarboxylase gene pyrF and orotic acid ribosyltransferase gene pyrE To achieve safe, efficient, and low-cost production of uracil.

RNA molecules comprising selenoribonucleosides are disclosed. In some embodiments, the RNA molecule is an mRNA molecule that encodes a polypeptide. In some embodiments, the nucleoside is situated in a coding region, polyA tail, 5' UTR, or 3' UTR. Also provided are methods of making and using the RNA molecules described herein.

A method for detecting a target polynucleotide, the method comprising: (1) providing a sample comprising or suspected of comprising the target polynucleotide; (2) subjecting the sample to an isothermal amplification, wherein the isothermal amplification comprises: combining the sample, one or more primers for the target polynucleotide, deoxyribonucleoside triphosphates (dNTPs), enzyme (s), and a magnesium salt, with functionalized gold nanoparticles, which are gold nanoparticles modified with poly (ethylene glycol) and 11-mercaptoundecanoic acid (MUA) (PEG / MUA-AuNPs), thereby forming an amplification mixture, and incubating the amplification mixture thereby forming an incubated mixture; and (3) detecting the target polynucleotide. The present method has high accuracy, sensitivity, specificity, is easy to operate, and can be used for decentralized (point-of-care / on-site) testing.

The present application provides a method for the in vitro transcription of a DNA template to RNA, the method comprising providing a mixture comprising a buffer substance, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure of Formula (I), (II), or (III), the mixture comprising a buffer substance, a ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure of Formula (I), (II), or (III), and incubating the reaction mixture at about 15 DEG C to about 35 DEG C, optionally about 18 DEG C to about 31 DEG C, for about 1 hour to about 12 hours, thereby producing the RNA.

The present invention addresses the problem of providing a novel method for synthesizing a deoxynucleoside triphosphate or nucleoside triphosphate.　This method for synthesizing a deoxynucleoside triphosphate (dNTP) from a deoxyribonucleoside or synthesizing a ribonucleoside triphosphate (NTP) from a ribonucleoside is characterized by: adding, to a reaction vessel, (i) a deoxyribonucleoside or ribonucleoside as a starting material, (ii) a kinase capable of producing a deoxyribonucleoside monophosphate from the deoxyribonucleoside or a ribonucleoside monophosphate from the ribonucleoside, a kinase capable of producing a deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or a ribonucleoside diphosphate from the ribonucleoside monophosphate, and a pyruvate kinase as enzymes, and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and a phosphoenolpyruvic acid (PEP) as phosphoric acid donors, thereby adjusting a reaction solution; and reacting the same in one pot.

The present application provides a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising a buffer, ribonucleoside triphosphates (NTPs), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure having formula (I), (II), or (III); and incubating the reaction mixture at about 15° C. to about 35° C., optionally about 18° C. to about 31° C., for about 1 hour to about 12 hours, thereby producing the RNA.

The disclosure relates to in vivo and ex vivo uses of dihydronicotinamide riboside (NRH), dihydronicotinic acid riboside (NARH) and reduced derivatives thereof to treat immune-related disorders (e.g., systemic inflammatory response syndrome and sepsis), kidney disorders (e.g., acute kidney injury and hepatorenal syndrome [HRS]), liver disorders (e.g., acute liver failure and HRS), hemolytic disorders (e.g., hemolysis and hemolytic anemia), and disorders and conditions associated with oxidative stress, damage or injury (e.g., methemoglobinemia and anemia). NRH, NARH and reduced derivatives thereof can be used in vivo or ex vivo alone or in combination with one or more additional therapeutic agents, such as an anti-inflammatory agent or / and an antioxidant.

The application discloses a method for enhancing 5'-cytidylic acid accumulation and application, and belongs to the field of genetic engineering and microbial engineering. The application knocks out ppnN, ushA, yrfG, yjjG, umpH and umpG genes, overexpresses 5'-CTP diphosphohydrolase gene nudG and orotidine-5'-phosphate ribosyltransferase gene pyrE, integrates expression of uridine phosphorylase mutant gene PyrH(R92G / D93G), further knocks out cytidine deaminase gene cdd and ribonucleoside-triphosphate reductase gene nrdD, and integrates expression of uridine-cytidine kinase gene udk, phosphoribosyl pyrophosphate synthetase gene prs, glucose-6-phosphate dehydrogenase gene zwf and 6-phosphogluconate dehydrogenase gene, so that the 5'-cytidylic acid accumulation capacity of Escherichia coli is improved. Under the condition that no antibiotic and inducer are added, the 5'-cytidylic acid yield of the recombinant bacteria reaches 39.6 g / L in a 60L fermenter.

The present disclosure generally relates to a composition for use in a therapeutic method of treatment or prevention of a retinal disease or retinal impairment, said composition comprising: A) carnitine, deoxycarnitine, acetyl-L-carnitine, gamma-butyrobetaine, 4- trimethylammoniobutanal, 3-hydroxy-N6,N6,N6-trimethyl-L-lysine, N6,N6,N6- trimethyl-L-lysine and / or lysine, preferably carnitine, such as L-carnitine; B) nicotinamide, nicotinamide riboside, quinolinate, deamino-NAD+, nicotinate D- ribonucleotide, nicotinamide D-ribonucleotide, nicotinate D-ribonucleoside, and / or nicotinate; C) optionally serine, glycine, betaine, N-acetylglycine, N-acetylserine, dimethylglycine, sarcosine and / or phosphoserine, preferably serine or glycine; and D) optionally N-acetyl cysteine, cysteine and / or cystine.

The invention discloses a preparation method of 3 '-propenyloxy furan ribonucleoside. The preparation method comprises the following steps: (1) protecting ribonucleoside by using tert-butyldimethylsilyl chloride; (2) carrying out complexing on the ribofuranoside protected by tert-butyldimethylsilyl chloride by using dioctyl tin oxide, so as to obtain a TBS-ribofuranoside-tin complex; (3) adding allyl methyl carbonate and tetrakis (triphenylphosphine) palladium into the TBS-ribonucleoside-tin complex for coupling, so as to obtain a coupling compound; 4, tetrabutylammonium fluoride is added into the coupling compound, a TBS protecting group is removed through a reaction, separation and purification are conducted, and the 3 '-propenyloxy ribofuranoside is obtained.According to the method, the 3'-propenyloxy ribofuranoside can be obtained only through one-time separation by adopting a three-step one-pot method, and industrial mass production is facilitated.