36 results about "Ribonucleoside" patented technology

The invention relates to the technical production field of metabolic engineering and genetic engineering, and particularly provides a uracil production strain as well as a construction method and application thereof. According to the strain, a uridine kinase gene udk is knocked out on an E.coli W3110 genome, and meanwhile, a T7RNA polymerase gene is integrated; the uridine monophosphate kinase gene pyrH is weakened; the method comprises the following steps: overexpressing a carbamyl phosphate synthetase gene carAB, a ribose phosphate pyrophosphate kinase gene prsA, a pyrimidine-5 '-nucleoside enzyme gene ppnN, UMP phosphohydrolase genes umpH and umpG, a ribonucleoside hydrolase 1 gene rihA and a glutamine synthetase gene glnA; an orotic acid nucleoside monophosphate decarboxylase gene pyrF and an orotic acid ribosyltransferase gene pyrE of wild type bacillus subtilis B.subtilis 168 are introduced in a heterologous manner, so that an orotate nucleoside monophosphate decarboxylase gene pyrF and an orotate ribosyltransferase gene pyrE are obtained. The safe, efficient and low-cost production of the uracil is realized.

The invention relates to the technical production field of metabolic engineering and genetic engineering, and particularly provides a genetically engineered bacterium for producing 2 '-deoxyuridine as well as a construction method and application of the genetically engineered bacterium. According to the strain, deoxyuridine kinase tdk is knocked out on an E.coli W3110 genome, and T7 RNA polymerase is integrated; an aspartate transaminase gene aspC, a glutamine synthetase gene glnA, a 5 '-deoxynucleotidase gene yfbR and a uridine monophosphate kinase gene pyrH are subjected to overexpression; the method comprises the following steps: introducing a ribonucleoside diphosphate reductase gene nrdBCA from Escherichia phage T4 in a heterologous series connection manner; the CTP synthase gene pyrG * of Corynebacterium glutamicum is introduced in a heterologous mode, and the CTP synthase gene pyrG * of Corynebacterium glutamicum is introduced in a heterologous mode. The safe, efficient and low-cost production of the 2 '-deoxyuridine is realized.

The present application relates to an Escherichia coli for synthesizing indigo blue and its construction method and application, and belongs to the technical field of biosynthesis of natural dyes. The indigo blue synthesizing Escherichia coli of the present application is characterized in that the Escherichia coli overexpresses glucose-promoting protein glf, glucose kinase glk and cell division inhibitory protein sulA; the Escherichia coli knocks out the fission protein ftsZ, the dynamic cytoskeleton protein mreB, and weakens the ribonucleoside reductase nrdA. The present application knocks out the cell fission protein ftsZ, the dynamic cytoskeleton protein mreB and the weakened ribonucleoside reductase nrdA of Escherichia coli, overexpresses the cell division inhibitory protein, glucose-promoting protein and glucose kinase, which can effectively prolong the cell division cycle without affecting its growth rate, increase the average cell volume, and thus achieve an increase in the indigo blue yield.

The present invention describes a composition comprising an effective amount of a combination of two or more components selected from acacetin, ACT1 peptide, α-lipoic acid, alprostadil, anisomycin, apigenin, ascorbic acid, astragalus, berberine, β-lapachone, β-hydroxy-β-methylbutyrate, bacopa monnieri, catechins, catechols, chamomile, chrysin, coumestrol, curcumin, dinitrophenol, dinoprost, ellagic acid, (-)-epigallocatechin gallate, green tea extract, fisetin, genistein, ginsenoside RE, glabridin, 18-α-glycyrrhetinic acid, 18-β-glycyrrhetinic acid, glycyrrhizin, hydroquinone, isoquercetin (EMIQ), shan Phosphate, black bean anthocyanins, leucine, lithium, luteolin, luteolin, luteolin, melatonin, menadione, 1‑methylnicotinamide (MNA), methyl salicylate, myricetin, nicotinamide adenine dinucleotide, nicotinic acid (vitamin B3), nicotinamide (NAM), nicotinamide mononucleotide (NMN), nicotinamide riboside (NR), nicotinic acid adenine dinucleotide (NaAD), nicotinic acid mononucleotide (NaMN), parsley, phenylephrine, pokeweed mitogen, 15‑Δ prostaglandin J2, puromycin, quercetin, quinolinic acid, retinoic acid, trichostatin A, troxerutin, rutin, tryptophan, vitamin D3, withaferin A, wortmannin, and zinc (including its salts).

The invention discloses a rapid culture system of mycoplasma pneumoniae. The rapid culture system comprises a growth-promoting additive A, a growth-promoting additive B and a growth-promoting additive C, wherein the growth-promoting additive A is A549 cell lysis buffer; the growth promoting additive B is a mixture of deoxyribonucleoside triphosphate and / or ribonucleoside triphosphate. The rapid culture system can promote rapid growth and reproduction of the mycoplasma pneumoniae, fully meets the nutritional requirements and growth requirements of the mycoplasma pneumoniae, and is of great significance to isolated culture, enrichment culture, epidemic disease prevention and control and molecular diagnosis of the mycoplasma pneumoniae. The invention also provides a culture method of the mycoplasma pneumoniae. The invention also provides application of the rapid culture system of the mycoplasma pneumoniae in in-vitro cell culture of the mycoplasma pneumoniae.

The invention discloses a method for constructing a blood serum endogenous biomarker and a depression diagnosis model of a depression patient, which couples non-targeting and targeting screening technologies, systematically characterizes endogenous small molecule metabolites in blood serum, identifies differential metabolites between the depression patient and a healthy control group, and determines the blood serum endogenous biomarker and the depression diagnosis model of the depression patient. And then determining a biomarker closely related to depression by using a regression model. According to the invention, potential depression biomarkers such as N-methyl-L-alanine, N-acetylneuraminic acid, N-acetylglycine, thymine ribonucleoside, decanoyl carnitine, aspartic acid-phenylalanine and the like are discovered. The diagnosis model obtained by training according to the ratio of N-acetylglycine to thymine ribonucleoside has the highest accuracy (99%), and healthy and disease samples can be effectively distinguished by using a threshold value 2.434. Therefore, the ratio of N-acetylglycine to thymine ribonucleoside is a potential biomarker capable of realizing rapid and accurate diagnosis of depression.

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.

This disclosure relates to 1H-pyrazolo[3,4-d]pyrimidine ribonucleoside compounds of Formula (I) and pharmaceutically acceptable salts thereof, which activate LACTB and are useful for treating diseases or disorders, such as cancer.

The invention discloses a method for rapidly detecting MTHFR (Methylene Tetrahydrofolate Reductase) gene polymorphism based on a complementary probe technology, which comprises the following steps: S1, acquiring a sample: extracting genome DNA (Deoxyribose Nucleic Acid) from a sample to be detected as an amplification template; s2, preparing a reaction system: adding the genome DNA, the upstream primer, the downstream primer, the C probe, the T probe, uracil-N-glycosylase, DNA polymerase, deoxyribonucleoside triphosphate and deoxyuridine triphosphate of the sample to be detected into the reaction system; s3, carrying out PCR (Polymerase Chain Reaction) amplification reaction under the conditions that the temperature is 90-98 DEG C, and the time is 5-20 minutes; performing denaturation at the temperature of 90-98 DEG C for 10-50 seconds; the temperature is 55-69 DEG C, and annealing is conducted for 60-120 s; the temperature is 68-72 DEG C, and extension is carried out for 15-300 s; carrying out 35 to 40 cycles; and S, genotype judgment. A test result is the same as a first-generation sequencing test result, which shows that the detection method of the scheme has relatively high accuracy. Meanwhile, compared with a sequencing method, the method has the advantages that a series of complex follow-up treatment does not need to be carried out on a PCR product, PCR amplification and detection are synchronously carried out, the detection time is greatly shortened, and the detection cost is reduced.

A method for transcribing a DNA template into RNA in vitro includes providing a mixture comprising a buffer material, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of from about 2 mM to about 60 mM, the DNA template, and a recombinant RNA polymerase, and incubating the reaction mixture at from about 25 DEG C to about 40 DEG C for from about 1 hour to about 12 hours, thereby producing the RNA. In one embodiment, a method for in vitro transcription includes providing a DNA template and a cap analog that binds-1 and / or + 1 nucleotides of a promoter for in vitro transcription, thereby producing mRNA of more complete length, allowing for more flexible selection of a first mRNA base, and providing a + 2 position open to a custom sequence.

The invention discloses a method for stereoselective synthesis of β-2'-deoxyribonucleosides. The method utilizes the diphenylphosphinoyl group on the glycosyl donor as a remote guiding group, so that it forms a bridged ring intermediate with the anomeric position of the glycosyl, and by shielding the same side of the sugar ring, the glycosyl acceptor can only perform nucleophilic attack on the anomeric position of the glycosyl donor from the side opposite to the group, thereby achieving stereoselective glycosidation of the opposite side. The method can efficiently control the stereoselectivity and regioselectivity of the glycosidation reaction, especially for the synthesis of nucleoside derivatives without adjacent groups participating in the C-2' group, showing great advantages. The method has mild reaction conditions and is easy to operate, and provides a new method for efficiently constructing a library of β-2'-deoxynucleoside derivatives.

The invention relates to a linearization method for NGS sequencing, a sequencing chip and a sequencing method. The linearization method comprises the following steps: introducing single ribonucleoside into a DNA primer, wherein the 2 '-OH position of the ribonucleoside is modified with a hydroxyl protecting group; during linearization, removing the hydroxyl protecting group by using a cutting reagent, and exposing 2 '-OH of ribonucleoside; a phosphodiester bond at the ribonucleoside position is cut off, so that one chain in the DNA primer is broken; the linear reaction formula is shown in the specification. According to the novel linearization method, one DNA chain can be cut and removed very quickly and efficiently, the single-stranded DNA template suitable for sequencing is obtained, and the novel linearization method has the advantages of low damage to DNA, capability of obviously improving the sequencing quality, good stability and capability of keeping stable sequencing quality in actual PE (Poly Ethylene) sequencing application. # imgabs0 #

The invention discloses a nucleic acid detection product, a system containing the nucleic acid detection product, a kit and a method for detecting Zika virus. The system comprises Tris, potassium acetate, DTT, polyethylene glycol 20000, deoxyribonucleoside triphosphate (dNTP), adenosine triphosphate (ATP), phosphocreatine, creatine kinase, Bsu, gp32, uvs X, uvs Y, Superscript IV Reverse Transcriptase, a primer pair, LbCas12a, a crRNA sequence, RNase H and magnesium acetate, and an RPA / CRISPR one-pot reaction can be realized, and detection is carried out through an electrochemical method. The system or the kit containing the system can realize rapid diagnosis of the Zika virus in different scenes, is simple and convenient in operation method and low in cost, has relatively high sensitivity and specificity, and is suitable for being applied to airports, disease control units and other grassroots units.

The invention provides a kit for DNA ligation reaction as well as a use method and application thereof. The kit comprises a first component and a second component, wherein the first component comprises a positively charged substance and a first buffer solution; the positively charged substance is selected from at least one of positively charged polypeptide, positively charged protein, positively charged synthetic macromolecule and positively charged glucan; the second component comprises a negatively charged substance and a second buffer solution; the negatively charged substance is selected from at least one of adenosine triphosphate, deoxyribonucleoside triphosphate, oligonucleotide and negatively charged polypeptide. The first component and the second component are arranged in the kit, when the first component and the second component are prepared into a reaction system, a condensate emulsion of hundreds of nanometers to several micrometers can be formed in situ, the condensate emulsion can spontaneously enrich all the components required by the reaction, and an emulsion matrix phase is a gel-like environment; and the ligation reaction efficiency and accuracy can be remarkably improved through the crowding effect between macromolecules.

This application relates to the field of metabolic engineering and genetic engineering technology for production, specifically providing a uracil-producing strain, its construction method, and its application. This strain is... E. coli Knockout of the uridine kinase gene in the W3110 genome udk Simultaneously integrates the T7 RNA polymerase gene; weakens the uridine kinase gene. pyrH Overexpression of carbamoyl phosphate synthase gene carAB ribose-phosphokinase gene prsA pyrimidine-5'-nucleotide nuclease gene ppnN UMP phosphohydrolase gene umpH and umpG Ribonucleotide hydrolase 1 gene rihA and glutamine synthase gene glnA Heterogeneous introduction of wild-type Bacillus subtilis B. subtilis 168 orotate nucleoside monophosphate decarboxylase gene pyrF and orotic acid ribosyltransferase gene pyrE To achieve safe, efficient, and low-cost production of uracil.

The invention provides a chromatographic method for separating and purifying deoxyribonucleoside. The chromatographic method comprises the following steps: 1) preparing a crude product containing deoxyribonucleoside and ribonucleoside into an upper column liquid; (2) enabling the upper column liquid to pass through a chromatographic column; 3) washing the chromatographic column with a tetraboric acid solution; and 4) eluting the chromatographic column with ethanol to obtain an eluent. The impurity removal mode is simple, convenient and easy to operate, low in cost and very suitable for large-scale production, the impurity removal efficiency can be greatly improved, and the production efficiency is further improved.

RNA molecules comprising selenoribonucleosides are disclosed. In some embodiments, the RNA molecule is an mRNA molecule that encodes a polypeptide. In some embodiments, the nucleoside is situated in a coding region, polyA tail, 5' UTR, or 3' UTR. Also provided are methods of making and using the RNA molecules described herein.

The present invention discloses a method for synthesizing a ribonucleic acid chain containing a non-natural base by a template-free enzymatic method and its application. A natural RNA initiation chain is mixed with a Poly(U) polymerase reaction buffer, and a ribonucleoside triphosphate containing a non-natural base is used as a substrate. Under the catalysis of the Poly(U) polymerase or its mutant, an RNA chain containing a non-natural base at the 3' end is obtained through an enzymatic reaction. The 3' end contains a non-natural base derivative TPT3 Al The RNA chain of TP can then continue to undergo click reactions with azide-modified fluorescent or other functional groups such as N3‑AF488 to achieve orthogonal labeling of RNA fluorescence or other functions. This method has high efficiency, low cost, easy operation, few by-products, and no polluting waste in synthesizing RNA containing non-natural bases. It has potential application value in the enzymatic synthesis of RNA chains containing non-natural bases and functional RNA end labeling.

A method for detecting a target polynucleotide, the method comprising: (1) providing a sample comprising or suspected of comprising the target polynucleotide; (2) subjecting the sample to an isothermal amplification, wherein the isothermal amplification comprises: combining the sample, one or more primers for the target polynucleotide, deoxyribonucleoside triphosphates (dNTPs), enzyme (s), and a magnesium salt, with functionalized gold nanoparticles, which are gold nanoparticles modified with poly (ethylene glycol) and 11-mercaptoundecanoic acid (MUA) (PEG / MUA-AuNPs), thereby forming an amplification mixture, and incubating the amplification mixture thereby forming an incubated mixture; and (3) detecting the target polynucleotide. The present method has high accuracy, sensitivity, specificity, is easy to operate, and can be used for decentralized (point-of-care / on-site) testing.

The invention relates to the field of enzymatic production of deoxyribonucleoside triphosphate, in particular to a method for enzymatic synthesis of deoxyribonucleoside triphosphate. According to the method, the salmon sperm DNA is subjected to enzymolysis through deoxyribonuclease to obtain dNMP, and the enzymolysis rate reaches 99.5% or above; and carrying out catalytic reaction on the dNMP obtained by enzymolysis by utilizing adenylate kinase, thymidylate kinase, cytidine monophosphate kinase, guanylate kinase, nucleoside diphosphate kinase and acetokinase to obtain corresponding dNTP, wherein the molar conversion rate is greater than 80%. The synthesis method is simple to operate, short in production period, easy to separate and purify and low in production cost, and has important industrial application prospects.

The present invention relates to a method for preparing 3'-O-amino-2'-deoxyribonucleoside-5'-triphosphates with reduced contamination with 3'-hydroxy-2'-deoxyribonucleoside-5'-triphosphate by converting 3'-(N-acetone-oxime)-2'-deoxynucleoside triphosphates into 3'-O-amine-2'-deoxynucleoside triphosphates by treatment with an aryl-hydroxylamine.

The invention provides a preparation method of a 3 '-methoxyl nucleoside analogue, which comprises the following steps: removing a 3'-protecting group of a compound V at high selectivity, adding methyl in situ so as to simply obtain a key methylation intermediate IV, and carrying out deprotection, acetylation, docking hydrolysis and other reactions on the intermediate IV, thereby obtaining the 3 '-methoxyl nucleoside analogue. The 3 '-methoxyl ribonucleoside analogue I is efficiently obtained. According to the present invention, the 3 '-site protection group is selectively removed so as to achieve the in-situ methylation, the reaction step is shortened, the reaction purity is substantially improved, the generation of the isomer is avoided, the purification pressure is reduced, the raw material cost is low, the reaction step is short, the use of the sodium hydrogen and other dangerous reagents is avoided, the operability is strong, and the yield is far higher than the yield in the prior art.

The invention relates to nucleoside derivatives of formula (I), wherein R has the same meaning as that defined in the claims and the description. The present invention also relates to pharmaceutical compositions comprising such compounds and to uses of such compounds and compositions for the treatment or prevention of viral infections, more in particular infections caused by RNA virus, such as coronavirus infections.

The present application provides a method for the in vitro transcription of a DNA template to RNA, the method comprising providing a mixture comprising a buffer substance, ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure of Formula (I), (II), or (III), the mixture comprising a buffer substance, a ribonucleoside triphosphate (NTP), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure of Formula (I), (II), or (III), and incubating the reaction mixture at about 15 DEG C to about 35 DEG C, optionally about 18 DEG C to about 31 DEG C, for about 1 hour to about 12 hours, thereby producing the RNA.

The present invention addresses the problem of providing a novel method for synthesizing a deoxynucleoside triphosphate or nucleoside triphosphate.　This method for synthesizing a deoxynucleoside triphosphate (dNTP) from a deoxyribonucleoside or synthesizing a ribonucleoside triphosphate (NTP) from a ribonucleoside is characterized by: adding, to a reaction vessel, (i) a deoxyribonucleoside or ribonucleoside as a starting material, (ii) a kinase capable of producing a deoxyribonucleoside monophosphate from the deoxyribonucleoside or a ribonucleoside monophosphate from the ribonucleoside, a kinase capable of producing a deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or a ribonucleoside diphosphate from the ribonucleoside monophosphate, and a pyruvate kinase as enzymes, and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and a phosphoenolpyruvic acid (PEP) as phosphoric acid donors, thereby adjusting a reaction solution; and reacting the same in one pot.

The present invention relates to a compound with general structure (I) or (II) or a pharmaceutically acceptable salt or prodrug thereofwherein R1 and R2 have the same meaning as that defined in the claims and the description. The present invention also relates to pharmaceutical compositions comprising such compounds and to uses of such compounds and compositions for the treatment or prevention of viral infections, more in particular infections caused by RNA virus.

Exemplary engineered synthetic genetic constructs are disclosed that can induce high levels of gene expression in response to changes in metabolism that are unique to solid tumors. These synthetic genetic constructs, hereafter referred to as promoters, can function in human cells, and can be used to specify or enhance the activity of chimeric antigen receptor (CAR) T cell therapies. CAR-T cell therapies are an important class of immunotherapies that is predicted to grow to be a 15B market by 2028 in the US. CAR-T cells and other autologous immune cell therapies have been shown to be deactivated by adenosine, an immunosuppressive small metabolite that accumulates to high levels in solid tumors. Accumulation of adenosine (e.g., ribonucleoside adenosine) can trigger a CREB-mediated signaling pathway to suppress the function of immune cells in solid tumor environments.

A colorimetric LAMP system includes a colorimetric LAMP reaction mixture and an extraction-free lysis buffer. The colorimetric LAMP reaction mixture is all-in-one lyophilized and includes a primer set, a strand-displacing polymerase and deoxyribonucleoside triphosphates for amplifying a target sequence; a pH indicating dye in a concentration ranged 0.08 to 0.3 mM; and a lyoprotectant sugar in a concentration ranged 1 to 10% (w / v), wherein the lyoprotectant sugar is selected from the group consisting of trehalose, raffinose, dextran, mannitol and mixtures thereof. The extraction-free lysis buffer includes potassium chloride in a concentration ranged 10 to 50 mM; ammonium sulfate in a concentration ranged 10 to 50 mM; and a detergent in a concentration ranged 0.5 to 6% (w / v). The lyophilized colorimetric LAMP reaction mixture is rehydrated with the extraction-free lysis buffer to be ready for nucleic acid amplification and detection.

The present application provides a method for in vitro transcription of a DNA template into RNA, the method comprising providing a mixture comprising a buffer, ribonucleoside triphosphates (NTPs), one or more magnesium salts at a concentration of about 2 mM to about 60 mM, the DNA template, a recombinant RNA polymerase, and a cap analog comprising a structure having formula (I), (II), or (III); and incubating the reaction mixture at about 15° C. to about 35° C., optionally about 18° C. to about 31° C., for about 1 hour to about 12 hours, thereby producing the RNA.