Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and application method thereof

A food-based, kit-based technology, which is applied in the directions of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, can solve the problems of long detection time, cumbersome operation, and difficulty in mass production, so as to achieve detection results. Fast process, high sensitivity and specific effect

Inactive Publication Date: 2013-12-11
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF2 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current laboratory diagnostic method mainly relies on the isolation and identification of bacteria, but this method takes a long time to detect, the operation is cumbersome, and it is difficult to carry out in large quantities.
At present, there are PCR and other detection methods established for a single pathogen, but there is no method and standard that can systematically detect multiple foodborne pathogens in chicken or chicken products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and application method thereof
  • Quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and application method thereof
  • Quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Chicken Common Foodborne Bacteria Quadruple Fluorescent PCR Detection Kit:

[0056] A quadruple fluorescent PCR detection kit for chicken common food-borne bacteria, the kit includes: Mg-free 2+ Fluorescence PCR reaction solution and standards of Clostridium perfringens, Salmonella, Escherichia coli O157:H7 and Campylobacter jejuni. The fluorescent PCR reaction solution includes the following components: rTaq DNA polymerase (TaKaRa Ltd), 10×PCR reaction buffer (TaKaRa Ltd), 25mM Mg 2+ (TaKaRa Ltd), 10mM dNTPs (TaKaRa Ltd), four pairs of bacterial specific primers (CP01, CP02, SE01, SE02, EC01, EC02, CJ01, CJ02) and corresponding four fluorescent probes (CPP, SEP, ECP , CJP).

[0057] Specific primer sequences include:

[0058] CP01 5'TGTAAGGCGCTTATTTGTGCT3'

[0059] CP02 5'CCCTTGAGTTACAATCATAGCATG3'

[0060] SE01 5'GCTGCTTTTCCTACTTAACAGTGC3'

[0061] SE02 5'CCAGTACGATATTCAGTGCGATC3'

[0062] EC01 5'TTCATGATGCTGTGGAAAACA3'

[0063] EC02 5'TGCTTGCAGAAGCCATATCA3' ...

Embodiment 2

[0072] Specificity and sensitivity of quadruple fluorescent PCR detection method for common foodborne bacteria in chickens:

[0073] 1. Materials and methods

[0074] (1) strain

[0075] Standard strains of Clostridium perfringens CVCC43, Salmonella enteritidis CVCC 3375, Escherichia coli CICC21530 and Campylobacter.jejuni ATCC33291 were purchased from China Microorganism Culture Collection center.

[0076] (2) Primers and probes

[0077] Download the nucleic acid sequences of Clostridium perfringens, Salmonella, Escherichia coli O157:H7, and Campylobacter jejuni from the NCBI database in the United States, and perform sequence comparison, design according to the conserved and specific gene sequence regions of the strains, and screen out each strain Specific primers and Taqman probes that do not interfere with each other, the sequences are as follows:

[0078] Specific primer sequences include:

[0079] CP01 5'TGTAAGGCGCTTATTTGTGCT3'

[0080] CP02 5'CCCTTGAGTTACAATCATAGC...

Embodiment 3

[0115] Quadruple Fluorescent PCR Detection of Chickens in Laboratory

[0116] The established quadruple fluorescent PCR method was used to detect 22 white-feathered broilers submitted by farmers (it can be completed within 2 hours).

[0117] 1. Preparation of bacterial DNA template

[0118] Use a sterilized cotton swab to take the anal swab of the live chicken to be inspected, dilute it with 200 μl PBS, take 100 μl of the diluted product and use the QIAxtractor high-throughput nucleic acid purification workstation to extract bacterial DNA, and use the Clostridium perfringens provided in the kit , Salmonella, Escherichia coli O157:H7 and Campylobacter jejuni standard as positive control, sterile water as negative control.

[0119] 2. Prepare the quadruple fluorescent PCR detection reaction system according to the following composition:

[0120]

[0121] Specific primer sequences include:

[0122] CP01 5'TGTAAGGCGCTTATTTGTGCT3'

[0123] CP02 5'CCCTTGAGTTACAATCATAGCATG3' ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quadruple fluorescent PCR (Polymerase Chain Reaction) detection kit for common chicken food-borne bacteria and an application method thereof. The kit contains a fluorescent PCR solution and standards of Clostridium perfringens, Salmonella enteritidis, Escherichia coli O157: H7 and Campylobacter jejuni, wherein the fluorescent PCR solution contains Taq DNA (deoxyribonucleic acid) polymerase, a PCR buffer solution, Mg<2+>, dNTPs (deoxy-ribonucleoside triphosphates), four pairs of bacterial specific primers and four kinds of corresponding fluorescent probes. According to the detection kit and the application method thereof, four kinds of chicken-carried main food-borne pathogenic bacteria, namely Clostridium perfringens, Salmonella enteritidis, Escherichia coli O157: H7 and Campylobacter jejuni, can be rapidly and accurately detected by using quadruple fluorescent PCR, and the detection kit can be applied to the assay of bacteria, the diagnosis of diseases and epidemiological investigation.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a quadruple fluorescent PCR detection kit for common chicken food-borne bacteria, and also relates to a method for using the quadruple fluorescent PCR detection kit for common chicken food-borne bacteria. Background technique [0002] Clostridium perfringens, Salmonella, Escherichia coli O157:H7 and Campylobacter jejuni are the four most common food-borne pathogenic bacteria carried by chickens. They not only seriously endanger the poultry industry in my country, but also infect humans through food contamination. pose a threat to human health. [0003] Clostridium perfringens is a zoonotic and foodborne pathogen. Chicken flocks are one of the main hosts of Clostridium perfringens. Clostridium perfringens is an opportunistic pathogen in chickens, which can cause necrotic enteritis in chickens. There are also many cases where the bacteria does not cause dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/145C12R1/42C12R1/19C12R1/01
Inventor 张腾飞王红琳罗玲张蓉蓉罗青平温国元邵华斌
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com