Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes

A specific and genetic technology, applied in the field of genetic engineering and gene knockout, to achieve the effect of high cost and long solution period

Active Publication Date: 2016-04-20
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF3 Cites 38 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the key technical problem of this approach is to design and prepare precisely targeted sgRNA, because the targeting accuracy of genes is highly dependent on the sgRNA target sequence, and whether the precise targeted sgRNA can be successfully designed becomes a key technical issue for knocking out the target gene , the present invention is intended to solve this technical problem so as to provide a solid foundation for knocking out the FGL2 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes
  • Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes
  • Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1, Selection and design of Susscrofa (pig) FGL2 gene sgRNA target sequence

[0066] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0067] 1. Selection of sgRNA target sequence for FGL2 gene

[0068] For the FGL2 gene, the following principles should be followed in the selection of target sequences:

[0069] (1) Find the target sequence in the exon coding region of the FGL2 gene that conforms to the 5'-N(20)NGG-3' rule, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence conforming to the rules can be located on the sense strand or the antisense strand;

[0070] (2) Select the sequence of the exon coding region, especially the sequence of the exon coding region near the N-terminus. The cu...

Embodiment 2

[0087] Example 2: Construction of the sgRNA expression vector of the FGL2 gene

[0088] 1. Synthesis of DNA Inserts

[0089] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0090] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 3 and No. 25 sequences listed in Table 1 on the knockout effect of the FGL2 gene was studied.

[0091] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 3 target sequence are as follows:

[0092] GACCGGCTTTTCTAGTCTCACCGGGC (SEQ ID NO: 80);

[0093] AAACGCCCGGTGAGACTAGAAAGCC (SEQ ID NO: 81).

[0094] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 25 target sequence are as follows:

[0095] CACCGGCAGTTTGGCAGGATTGAGG (SEQ ID NO: 82);

[009...

Embodiment 3

[0132] Example 3. Obtaining a pseudotyped lentivirus expressing FGL2sgRNA

[0133] 1. Material preparation

[0134] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-FGL2; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0135] 2. Transfection and Viral Packaging

[0136] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;

[0137] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0138] Prepare Mixture 1, containing:

[0139] lentiCRISPRv2-FGL2: 6 μg

[0140] pL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes. The target sequence of the sgRNA of the specificity targeting FGL2 genes on the FGL2 genes meets a sequence arrangement rule of 5'-N(20) NGG- 3'; N(20)represents 20 continous basic groups; each N indicates A, T, C or G; the target sequence on the FGL2 is placed in exon encoding areas of the FGL2; and the target sequence on the FGL2 genes are unique. In the method knocking out pig FGL2genes with CRISPR-Cas9 specificity, FGL2genes of the pigs can be quickly, accurately and high-efficiently knocked out in a specific way; and problems of long term and high cost during gene knockout of the FGL2genes can be solved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a method for specifically knocking out the pig FGL2 gene by CRISPR-Cas9 and an sgRNA for specifically targeting the FGL2 gene. Background technique [0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relying ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867A01K67/027
CPCC12N15/11C12N15/86
Inventor蔡志明牟丽莎高汉超谢崇伟陆赢刘璐陈鹏飞张军方
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN