Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

39 results about "Cyprinid herpesvirus" patented technology

The recently designated cyprinid herpesvirus 3 (CyHV-3) is an emerging agent that causes fatal disease in common and koi carp. Since its emergence in the late 1990s, this highly contagious pathogen has caused severe financial losses in common and koi carp culture industries worldwide.

CyHV-2 (Cyprinid Herpesvirus 2) monoclonal antibody, hybridoma cell and application of CyHV-2 monoclonal antibody

The invention discloses a CyHV-2 (Cyprinid Herpesvirus 2) monoclonal antibody, a hybridoma cell and an application of the CyHV-2 monoclonal antibody. The CyHV-2 monoclonal antibody disclosed by the invention is secreted from a hybridoma cell GFHNV-6G7 with the collection number of CCTCC No. C2013114 or hybridoma cell GFHNV-3B5 with the collection number of CCTCC No. C2013115. The CyHV-2 monoclonal antibody disclosed by the invention has good specificity and potency; by producing rapid immunodetection test paper from the CyHV-2 monoclonal antibody, the speed and efficiency of detection can be increased, and field detection on CyHV-2 can be realized. The CyHV-2 monoclonal antibody disclosed by the invention makes up the blank in immunodetection on the CyHV-2 and lays a foundation for immunological research on the CyHV-2.
Owner:SHENZHEN AUDAQUE DATA TECH

Detection kit and detection method for Cyprinid herpesvirus III

The invention discloses a primer pair which is used for amplification of a TK gene sequence of Cyprinid herpesvirus III. The invention also discloses an amplification method for the TK gene sequence of the Cyprinid herpesvirus III. The invention discloses a detection kit for the Cyprinid herpesvirus III. The invention discloses a method for detecting the Cyprinid herpesvirus III by using a fluorescent quantitative detection kit. The detection kit and the method can provide assurance for rapid and accurate detection of the Cyprinid herpesvirus III, and provide guarantee for disease prevention, scientific medication and fish health. The detection method and the kit on the basis of a special primer provided by the invention can be used for a nucleic acid test of a TK gene of main diseased tissues (the liver, the brain and the kidney) of fish.
Owner:INST OF AQUATIC LIFE ACAD SINICA +1

CyHV-2 (cyprinid herpesvirus 2) specificity PCR (polymerase chain reaction) detection kit and detection method

The invention belongs to the technical field of reproduction, and particularly relates to a CyHV-2 (cyprinid herpesvirus 2) specificity PCR (polymerase chain reaction) detection kit and a detection method. The CyHV-2 specificity PCR detection kit comprises 2*reaction mixing buffer solutions (1.0mL), preferably designed upstream and downstream primers, Taq DNA (deoxyribonucleic acid) polymerase, positive contrast liquid, negative contrast liquid and ddH2O. The invention overcomes defects of the existing CyHV-2 detection method, and provides the novel PCR fast detection kit and the detection method. The CyHV-2 specificity PCR detection kit and the detection method have the advantages that the clinical diagnosis of CyHV-2 is feasible, in addition, the advantages of high speed, accuracy and specificity are realized, the clinical diagnosis requirements are met, and convenient conditions are provided for CyHV-2 detection.
Owner:广州利洋水产科技股份有限公司

Cyprinid herpesvirus ii-sensitive brain tissue cell line of carassius auratus gibelio and establishing method and use thereof

The present invention discloses a cyprinid herpesvirus II-sensitive brain tissue cell line of Carassius auratus gibelio and establishing method and use thereof. The cell line is deposited in China Center for Type Culture Collection under an accession number of CCTCC No: C2013179. The brain tissue cell line of Carassius auratus gibelio is in good growth state and sensitive to CyHV-2 that is presently hardly cultured with ordinary fish cell lines. After six passages of CyHV-2 in GiCB cells, viral nucleic acid can still be detected and a cytopathic effect is stable. When ultrathin microscopic sections are prepared from cells having the cytopathic effect, considerable mature CyHV-2 virions and their replication process can be observed in GiCB cells. The construction method of the brain tissue cell line of Carassius auratus gibelio of the present invention has high repeatability, scientific and reasonable conditions.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Cyprinid herpesvirus detection kit and detection method thereof

ActiveCN104032037AImprove positive detection rateReduce False Negative TestsMicrobiological testing/measurementCyprinid herpesvirus 3Buffer solution
The invention relates to a Cyprinid herpesvirus detection kit and a detection method thereof, belonging to the technical field of virus genome detection. The detection kit comprises a 10* reaction buffer solution, a 1U / mu L Taq enzyme, a primer set composed of 10 mu M of P1F and 10 mu M of P1R, a primer set composed of 10 mu M of P2F and 10 mu M of P2R, pure water and a 15 mu g / mL positive DNA. The kit can be used for simultaneously detecting genomes of carp pox herpesvirus, haematopoietic necrosis herpesvirus of goldfish and Koi herpesvirus. The method has the advantages of excellent visuality, favorable sensitivity and high specificity, has favorable effects on detecting trace amounts of Cyprinid herpesvirus genome in the long-storage-time specimen, and can be used for Cyprinid-herpesvirus-infected laboratory detection and Cyprinid herpesvirus molecule epidemiological survey.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

Cyprinid herpesvirus II DNA vaccine based on baculovirus vector as well as building method and application thereof

The invention relates to a cyprinid herpesvirus II DNA vaccine based on a baculovirus vector as well as a building method and application thereof. Codons of regional sequences 1-186, 993-1197, 603-783and 85-186 nt of cyprinid herpesvirus II ORF72, ORF66, ORF81 and ORF82 are optimized; then, ORF72-ORF66-ORF81-ORF82 fusion sequences are chemically synthesized; next, the promoter control is performed; the clone into the baculovirus transfer vector pFSATBacTMDual is performed to build recombinant plasmids pFSATBacTMDual-FA-D4ORF; after the plasmids are used for converting DH10 / Bac competent cells, Bacmid-FA-D4ORF is obtained; after the Bacmid-FA-D4ORF DNA is used for transfecting silkworm culture cells, BmNPV-FA-D4ORF is obtained and is the cyprinid herpesvirus II DNA vaccine based on the baculovirus vector. The DNA vaccine can realize the immune on carassius auratus gibelio by using an injection or oral administration or soaking method; the gill bleeding diseases of the carassius auratusgibelio can be reduced.
Owner:苏州培恩特生物科技有限公司

Lactobacillus casei YFI-5 and application thereof in resistance of cyprinid herpesvirus 2

ActiveCN110468069ANo side effectsNo antiviralBacteriaLactobacillusSide effectCyprinid herpesvirus 3
The invention relates to the technical field of aquatic antiviral microecological preparation, and in particular, relates to lactobacillus casei YFI-5 and an application thereof in resistance of cyprinid herpesvirus 2 (CyHV-2). The lactobacillus casei has the preservation number of CCTCC NO:M2019654. A fermentation supernatant of the lactobacillus casei YFI-5 can reduce the infection activity of CyHV-2 on host cells and inhibit the infection of CyHV-2 virus invasion on the cells, and has no side effects on cells. The feed with addition of the lactobacillus casei YFI-5 can effectively reduce the mortality rate of crucian carp infected by CyHV-2, and can be used for preventing and treating crucian carp hematopoietic necrosis.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Carassius auratus gibelio anti-CyHV-2 oral recombinant spore vaccine and preparation method thereof

The invention relates to a Carassius auratus gibelio anti-Cyprinid herpesvirus 2 (CyHV-2) oral recombinant Bacillus subtilis spore vaccine and a preparation method thereof. The vaccine is prepared by coating recombinant Bacillus subtilis spore CyHV-2 having a surface showing a CyHV-2 immune protective antigen with a Carassius auratus gibelio granular feed; and the above spore is a spore with germination defects and no antibiotic-resistant gene markers. The preparation method comprises the following steps: constructing the recombinant Bacillus subtilis spore CyHV-2 having germination defects, having no antibiotic resistance gene markers and having a surface showing the CyHV-2 immune protective antigen, and preparing the Carassius auratus gibelio granular feed coated CyHV-2 oral recombinant Bacillus subtilis spore vaccine used for preventing and treating CyHV-2 induced Carassius auratus gibelio hemorrhage. The oral recombinant Bacillus subtilis spore vaccine having germination defects, having no antibiotic resistance gene markers and having a surface showing the CyHV-2 immune protective antigen, prepared in the invention, has the characteristics of safety and high efficiency.
Owner:INST OF AQUATIC LIFE ACAD SINICA

RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit

The invention discloses an RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and a primer and a probe special for the RPA kit. The forward primer sequence ofthe primer special for the RPA is CCCAGGAGACCAGCAGACTGTTGAACCCGTAC, and the reverse primer sequence of the primer is GTATCCGCCTCGTCCATCATAGAGCCGAAACC; the sequence of the probe is cactctggcgacgcgtttgtggttgaaccgcca(BHQ1-dt)c(THF)g(FAM-dT)ggaggcttcaaaggc(C3spacer), a (BHQ1-dt) perssad exists in the 34 bp, a (THF) perssad exists in the 36 bp, an (FAM-dT) perssad exists in the 38 bp, and (C3spacer) is contained in the tail for modification. By means of the RPA kit including the primer and the probe, cyprinid herpesvirus 2, CyHV-II can be quickly and successfully detected.
Owner:SHANGHAI OCEAN UNIV

RPA kit used for detecting Cyprinid herpesvirus II, and special primer and probe thereof

The invention discloses a RPA kit used for detecting Cyprinid herpesvirus II, and a special primer and a probe thereof. The forward primer sequence of the RPA special primer is CAATCAGGGTCAGTGGACGAGACTGGCGTTGT, and the reverse primer sequence is CCTCCCAGAGCCATGTTACCCGGTCTGAAGGA; the probe sequence is (FAM)cactctggcgacgcgtttgtggttgaaccgccaTc(THF)gTggaggcttcaaaggc(C3spacer). The kit containing the above RPA special primer and the probe can be used for visualization detection of Cyprinid herpesvirus II in 15min at 37 DEG C constant temperature conditions.
Owner:SHANGHAI OCEAN UNIV

Cyprinid herpesvirus II type sandwich ELISA detection kit and detection method

InactiveCN106771134AOptimal working concentrationOptimal reaction timeMaterial analysisPositive controlBody solution
The invention relates to a cyprinid herpesvirus II type sandwich ELISA detection kit. The kit mainly comprises a cyprinid herpesvirus II type ORF90 purified monoclonal antibody solution, an enzyme-labeled ORF90 polyclonal body solution, a diluent, a TMB substrate solution, a stop solution, cyprinid herpesvirus II type positive control, negative control, coating liquid and a 96-pore enzyme-labeled plate. The invention also relates to a detection method. The kit and the method, provided by the invention, can be applied to detection of latent infected fish virus without clinical symptom and can further be applied to research on the change rule of the cyprinid herpesvirus II type in the fish body, so that basis is provided for prevention and control of the virus. The method provided by the invention does not have specific reaction with other common viruses of crucian and goldfish, and can be applied to diagnosis of epidemic disease in domestic farms as well as exit and entry fish quarantine.
Owner:LIANYUN PORT IMMIGRATION INSPECTION & QUARANTINE BUREAU PEOPLES REPUBLIC OF CHINA

Carassius auratus gibelio feed for preventing and treating cyprinid herpesvirus-2

The invention relates to a carassius auratus gibelio feed for preventing and treating cyprinid herpesvirus-2. The feed is mainly composed of the following raw materials: fish meal, puffed soybeans, soybean meal, rapeseed meal, cottonseed meal, fine rice bran, flour, soybean oil, monocalcium phosphate, zeolite powder, bentonite, a vitamin premix and a Chinese herbal medicine feed additive. The feedof the invention can effectively reduce the occurrence of diseases in breeding processes, particularly the occurrence of fulminating bleeding diseases, and can improve the survival rate of carassiusauratus gibelio, and promote the growth of the carassius auratus gibelio.
Owner:无锡三智生物科技有限公司

RAA amplification primer and probe for rapid detection of Cyprinid herpesvirus type II, detection kit and application method thereof

The invention discloses a RAA amplification primer and a probe for rapid detection of Cyprinid herpesvirus II, a detection kit and an application method thereof. The RAA isothermal amplification system of the invention has fast reaction and wide temperature range, can realize effective amplification of target genes at 34-40 DEG C, has a lowest detection limit of 8.14*100 copies / microliter, has a higher sensitivity than common PCR of CyHV-2, and will not cross-react with other aquatic animal epidemics. The kit of the invention can quickly, efficiently and sensitively detect Cyprinid herpesvirus II, is simple to operate, has high specificity, is easy to observe reaction results, and is safe and pollution-free. The invention not only provides an effective technical means for on-site rapid detection and screening of Cyprinid herpesvirus type II infection nucleic acid, but also has very important significance for controlling the infection transmission of the virus in ornamental fish such as crucian carp and goldfish and the inspection and quarantine in epidemic areas and entry and exit ports.
Owner:北京市水产技术推广站

Construction method of protein microcrystal embedded CyHV-2 (cyprinid herpesvirus II)-type-GCRV (grass carp reovirus) subunit vaccine based on yeast expression vector

The invention relates to a construction method of a protein microcrystal embedded CyHV-2 (cyprinid herpesvirus II)-type-GCRV (grass carp reovirus) subunit vaccine based on a yeast expression vector. An AOX1 promoter is used for controlling a silkworm cypovirus protein gene; a TEF1 promoter is used for controlling VP6 and VP7 from GCRV and CyHV-2 ORF72, ORF66, ORF81, ORF82 and an antigenic epitopefusion sequence VP6-VP7-ORF72-ORF66-ORF81-ORF82-VP3 obtained after codon optimization of cypovirus VP3. The vector transforms yeast, inducible expression is performed through methanol, expressed poly-antigen epitope fusion protein is embedded in recombinant cypovirus protein under the guide of cypovirus VP3, a protein microcrystal of embedded CyHV-2-GCRV is formed, the protein microcrystal is split by a sodium carbonate-sodium bicarbonate solution, the pH is regulated to 7.12 with a hydrochloric acid solution, and a supernatant obtained after centrifugation is CyHV-2-GCRV joint subunit vaccineantigen.
Owner:SUZHOU UNIV

pORF65 recombinant protein and preparation method and application thereof

The invention discloses a pORF65 recombinant protein and a preparation method and application thereof. The pORF65 recombinant protein comprises amino acid sequences shown in the formulas of SEQ ID NO.17 to SEQ ID NO.21 orderly connected by connexins, and the connexin is composed of 4-7 hydrophilic amino acids with small molecular weight and polarity. The ELISA result shows that the pORF65 recombinant protein can be used as a coating antigen and can well detect a serum-specific antibody produced by a cryprinus carpiod immunized by a DNA vaccine constructed from a complete coding sequence of CyHV-3 pORF65 and diagnose whether the cryprinus carpiod infects cyprinid herpesvirus III.
Owner:INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI

Cyprinid herpesvirus II-sensitive brain tissue cell line of Carassius auratus gibelio and establishing method and use thereof

The present invention discloses a cyprinid herpesvirus II-sensitive brain tissue cell line of Carassius auratus gibelio and establishing method and use thereof. The cell line is deposited in China Center for Type Culture Collection under an accession number of CCTCC No: C2013179. The brain tissue cell line of Carassius auratus gibelio is in good growth state and sensitive to CyHV-2 that is presently hardly cultured with ordinary fish cell lines. After six passages of CyHV-2 in GiCB cells, viral nucleic acid can still be detected and a cytopathic effect is stable. When ultrathin microscopic sections are prepared from cells having the cytopathic effect, considerable mature CyHV-2 virions and their replication process can be observed in GiCB cells. The construction method of the brain tissue cell line of Carassius auratus gibelio of the present invention has high repeatability, scientific and reasonable conditions.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Bacillus velezensis YFI-4, and application thereof in preparation of drugs for treating viral diseases of freshwater cultured animals

The invention relates to the technical field of aquatic antiviral micro-ecological preparations, and especially relates to a bacillus velezensis YFI-4, and application thereof in preparation of drugsfor treating viral diseases of freshwater cultured animals. The preservation number of the bacillus velezensis disclosed by the invention is CCTCC NO: M2019653. The bacillus velezensis YFI-4 disclosedby the invention is used for fermenting supernatant, reduces infection activity of koi herpesvirus (KHV), cyprinid herpesvirus type 2 (CyHV-2), giant salamander iridovirus (GSIV) and the like on hostcells, inhibits infection of virus invasion on the cells is inhibited, and has no toxic or side effect on the cells and can be used for preventing and treating viral diseases of freshwater cultured animals.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Immune Index Indicating Carp's Anti-herpes Virus Ability

The invention discloses an immunity index for indicating cyprinid herpesvirus resistance and relates to an immunity index for indicating cyprinid virus resistance. The immunity index for indicating cyprinid herpesvirus resistance, disclosed by the invention, includes activity of alkaline phosphatase (AKP). According to the invention, the immunity index for indicating cyprinid herpesvirus resistance is found, and the activity of the infected immunity index molecule for indicating cyprinid herpesvirus resistance is consistent with the survival rate of the infected carp. Therefore, the immunity index for indicating cyprinid herpesvirus resistance, disclosed by the invention, can accurately reflect the disease resistance.
Owner:HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI

Antigen protein, monoclonal antibody or polyclonal antibody thereof and application

PendingCN114685619AAntigenicity analysis results are excellentGood pairingVirus peptidesMicroorganism based processesPolyclonal antibodiesAntigenic protein
The embodiment of the invention relates to an antigen protein as well as a monoclonal antibody or a polyclonal antibody and application thereof. The antigen protein comprises 45th to 56th amino acids, 76th to 95th amino acids, 124 to 145th amino acids and 176th to 281 amino acids of cyprinid herpesvirus type 2 ORF153 protein which are sequentially connected through connecting sequences from an N segment to a C segment. According to the antigen protein with the hydrophobic region expressed in the original ORF153 protein removed, the antigenicity analysis result shows that the antigen protein is superior to the original ORF153 protein, and the monoclonal antibody or the polyclonal antibody obtained by utilizing the antigen protein can be used for detecting the cyprinid herpesvirus type 2.
Owner:CHINESE ACAD OF INSPECTION & QUARANTINE

A kind of attenuated strain of carp herpesvirus type II and its application

The invention belongs to the technical field of vaccine preparation, and particularly provides a cyprinid herpesvirus 2 attenuated strain and an application thereof. The cyprinid herpesvirus 2 provided by the invention is a cyprinid herpesvirus 2 DX2019 strain, and the preservation number is CCTCC NO:V201980. A vaccine prepared by using the strain can prevent diseases caused by the cyprinid herpesvirus 2, has an immune protection effect of 92 percent or above, does not generate a stress reaction to organisms, and can be applied to prevention of haematopoietic organ necrosis of crucian carps, so that the incidence rate of haematopoietic organ necrosis of the crucian carps in a crucian carp culture pond is reduced, and the survival rate of the crucian carps is improved.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

A baculovirus vector-based carp herpes virus type II dna vaccine and its construction method and application

The invention relates to a cyprinid herpesvirus II DNA vaccine based on a baculovirus vector as well as a building method and application thereof. Codons of regional sequences 1-186, 993-1197, 603-783and 85-186 nt of cyprinid herpesvirus II ORF72, ORF66, ORF81 and ORF82 are optimized; then, ORF72-ORF66-ORF81-ORF82 fusion sequences are chemically synthesized; next, the promoter control is performed; the clone into the baculovirus transfer vector pFSATBacTMDual is performed to build recombinant plasmids pFSATBacTMDual-FA-D4ORF; after the plasmids are used for converting DH10 / Bac competent cells, Bacmid-FA-D4ORF is obtained; after the Bacmid-FA-D4ORF DNA is used for transfecting silkworm culture cells, BmNPV-FA-D4ORF is obtained and is the cyprinid herpesvirus II DNA vaccine based on the baculovirus vector. The DNA vaccine can realize the immune on carassius auratus gibelio by using an injection or oral administration or soaking method; the gill bleeding diseases of the carassius auratusgibelio can be reduced.
Owner:苏州培恩特生物科技有限公司

Recombinant baculovirus expression vector of ORF66 protein of cyprinid herpesvirus II and preparation method thereof

The invention provides a recombinant baculovirus expression vector of an ORF66 protein of cyprinid herpesvirus II and a preparation method thereof. An ORF66 gene is amplified with extracted CyHV-2 cDNA as a template, the amplified ORF66 gene is connected to a baculovirus vector pFastBacHTA, a recombinant baculovirus vector pFastBac HTA-CyHV-ORF66 is constructed and is transformed into an escherichia coli competent cell DH10Bac, and a recombinant shuttle bacmid rBacmid-CyHV-ORF66 is obtained; after being identified to be correct, the recombinant shuttle bacmid rBacmid-CyHV-ORF66 is transfectedto an Sf9 insect cell, and a recombinant baculovirus is obtained; the recombinant baculovirus is subjected to passage amplification, the baculovirus containing the CyHV-2-ORF66 gene and having high titer is inoculated into the sf9 insect cells, and eukaryotic expression of a CyHV-2-ORF66 protein is carried out. The method is selected for constructing the recombinant baculovirus expression vector of the ORF66 protein of the cyprinid herpesvirus II, and the recombinant baculovirus expression system is used for expressing the ORF66 protein of the cyprinid herpesvirus II in the insect cell, provides materials for preparation of a specific monoclonal antibody of the ORF66 protein of the cyprinid herpesvirus II, and lays a foundation for a cyprinid herpesvirus serological ELISA detection method.
Owner:YANCHENG INST OF TECH

Method for preparing baculovirus-loaded cyprinid herpesvirus type II DNA vaccine by freeze drying

The invention relates to a method for preparing baculovirus-loaded cyprinid herpesvirus type II DNA vaccine by freeze drying. The recombinant virus BmNPV-FA-D4ORF is inoculated to bombyx mori, then the diseased bombyx mori is homogenized and freeze-dried, freeze-dried powder is prepared, and the cyprinid herpesvirus II type DNA vaccine is obtained; and the freeze-drying step comprises the steps of pre-freezing overnight at -80 DEG C, and then carrying out low-pressure stepped heating drying. The freezing method is limited, and the application effect is further improved on the basis that the existing recombinant virus BmNPV-FA-D4ORF is inoculated to the bombyx mori and then the diseased bombyx mori is homogenized.
Owner:SUZHOU UNIV

A kind of carp herpes virus type Ⅱ sandwich ELISA detection kit and detection method

InactiveCN106771134BOptimal working concentrationOptimal reaction timeMaterial analysisPositive controlQuarantine
The invention relates to a cyprinid herpesvirus II type sandwich ELISA detection kit. The kit mainly comprises a cyprinid herpesvirus II type ORF90 purified monoclonal antibody solution, an enzyme-labeled ORF90 polyclonal body solution, a diluent, a TMB substrate solution, a stop solution, cyprinid herpesvirus II type positive control, negative control, coating liquid and a 96-pore enzyme-labeled plate. The invention also relates to a detection method. The kit and the method, provided by the invention, can be applied to detection of latent infected fish virus without clinical symptom and can further be applied to research on the change rule of the cyprinid herpesvirus II type in the fish body, so that basis is provided for prevention and control of the virus. The method provided by the invention does not have specific reaction with other common viruses of crucian and goldfish, and can be applied to diagnosis of epidemic disease in domestic farms as well as exit and entry fish quarantine.
Owner:LIANYUN PORT IMMIGRATION INSPECTION & QUARANTINE BUREAU PEOPLES REPUBLIC OF CHINA

Carp herpes virus detection kit and detection method thereof

The invention relates to a Cyprinid herpesvirus detection kit and a detection method thereof, belonging to the technical field of virus genome detection. The detection kit comprises a 10* reaction buffer solution, a 1U / mu L Taq enzyme, a primer set composed of 10 mu M of P1F and 10 mu M of P1R, a primer set composed of 10 mu M of P2F and 10 mu M of P2R, pure water and a 15 mu g / mL positive DNA. The kit can be used for simultaneously detecting genomes of carp pox herpesvirus, haematopoietic necrosis herpesvirus of goldfish and Koi herpesvirus. The method has the advantages of excellent visuality, favorable sensitivity and high specificity, has favorable effects on detecting trace amounts of Cyprinid herpesvirus genome in the long-storage-time specimen, and can be used for Cyprinid-herpesvirus-infected laboratory detection and Cyprinid herpesvirus molecule epidemiological survey.
Owner:ZHEJIANG INST OF FRESH WATER FISHERIES

A kind of heterogeneous gibel crucian carp anti-CYHV-2 oral recombinant spore vaccine and its preparation method

The invention relates to a Carassius auratus gibelio anti-Cyprinid herpesvirus 2 (CyHV-2) oral recombinant Bacillus subtilis spore vaccine and a preparation method thereof. The vaccine is prepared by coating recombinant Bacillus subtilis spore CyHV-2 having a surface showing a CyHV-2 immune protective antigen with a Carassius auratus gibelio granular feed; and the above spore is a spore with germination defects and no antibiotic-resistant gene markers. The preparation method comprises the following steps: constructing the recombinant Bacillus subtilis spore CyHV-2 having germination defects, having no antibiotic resistance gene markers and having a surface showing the CyHV-2 immune protective antigen, and preparing the Carassius auratus gibelio granular feed coated CyHV-2 oral recombinant Bacillus subtilis spore vaccine used for preventing and treating CyHV-2 induced Carassius auratus gibelio hemorrhage. The oral recombinant Bacillus subtilis spore vaccine having germination defects, having no antibiotic resistance gene markers and having a surface showing the CyHV-2 immune protective antigen, prepared in the invention, has the characteristics of safety and high efficiency.
Owner:INST OF AQUATIC LIFE ACAD SINICA

cyhv‑2 monoclonal antibody, hybridoma cells and applications

The invention discloses a CyHV-2 (Cyprinid Herpesvirus 2) monoclonal antibody, a hybridoma cell and an application of the CyHV-2 monoclonal antibody. The CyHV-2 monoclonal antibody disclosed by the invention is secreted from a hybridoma cell GFHNV-6G7 with the collection number of CCTCC No. C2013114 or hybridoma cell GFHNV-3B5 with the collection number of CCTCC No. C2013115. The CyHV-2 monoclonal antibody disclosed by the invention has good specificity and potency; by producing rapid immunodetection test paper from the CyHV-2 monoclonal antibody, the speed and efficiency of detection can be increased, and field detection on CyHV-2 can be realized. The CyHV-2 monoclonal antibody disclosed by the invention makes up the blank in immunodetection on the CyHV-2 and lays a foundation for immunological research on the CyHV-2.
Owner:SHENZHEN AUDAQUE DATA TECH

RAA (Recombinase-aid Amplification) constant-temperature fluorescence detection method and reagent of cyprinid herpesvirus II (CyHV-2)

The invention discloses a RAA (Recombinase-aid Amplification) constant-temperature fluorescence detection method and detection reagent kit of cyprinid herpesvirus II (CyHV-2). The detection reagent kit comprises a forward primer SEQID NO.1, a reverse primer SEQID NO.2, a specific fluorescence probe SEQID NO.3, reaction liquid, recombinant polymerase and a reference substance. The reagent kit disclosed by the invention is high in specificity, high in detection sensitivity which can reach 100 fg / [mu]L, high in accuracy, reliable, simple, convenient and quick to operate and suitable for on-site detection, and has broad application scene.
Owner:HANGZHOU ZHONGCE BIO SCI&TECH CO LTD

Application of ferrous ions in the prevention and treatment of carp herpes virus type Ⅱ (cyhv2) infection

The invention discloses the application of ferrous ions in the prevention and treatment of cyprinid herpesvirus 2 (CyHV2) infection. The establishment of experimental animal infection models shows that ferrous chloride can significantly protect crucian carp from CyHV2 infection. Combined with the results of qPCR experiments, it was found that the transcription level of virus-related genes was significantly inhibited after ferrous chloride treatment. Therefore, the compound containing ferrous ions can be used as a drug for preventing and treating CyHV2, and has the advantages of non-toxic and safe dosage and good protective effect.
Owner:INST OF AQUATIC LIFE ACAD SINICA
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More