55 results about "Bombyx mori" patented technology

The invention belongs to the technical field of agricultural biology, and particularly relates to application of an endoplasmic reticulum protein antioxidant (reducing agent) in prevention and treatment of bombyx mori nuclear polyhedrosis virus. A screening test finds that the related endoplasmic reticulum protein antioxidants beta-mercaptoethanol (BME), dithiothreitol (DTT) and / or tris (2-carboxyethyl) phosphine (TCEP) have the effect of inhibiting the bombyx mori nuclear polyhedrosis virus (BmNPV), and the antioxidants interfere the replication and proliferation of the virus by destroying disulfide bonds in key proteins of the BmNPV, so that the bombyx mori nuclear polyhedrosis virus can be inhibited. The stability and activity of virions are directly influenced, so that the infection of the viruses on the silkworms is inhibited, a brand new thought is provided for the development of antiviral drugs of the silkworms, and the application value is good.

The invention discloses application of bombyx mori chemosensory protein BmCSP4 and a method for breeding bombyx mori varieties, and relates to the technical field of biology, the application of the bombyx mori chemosensory protein BmCSP4 is used for breeding high-yield bombyx mori varieties, the nucleotide sequence of the BmCSP4 is shown as SEQ ID NO.16, and the high yield refers to increase of pupa weight or increase of cocoon shell weight. The transgenic bombyx mori provided by the invention shows obvious individual development advantages, and related economic characters, such as transgenic overexpressed bombyx mori female and male average pupa weights, are respectively improved by 9.94% and 8.36% compared with wild type bombyx mori; and the average cocoon weights of female and male transgenic overexpressed bombyx mori are respectively improved by 8.49% and 17.2% compared with those of wild type bombyx mori.

The application discloses a method for improving secretion of antibacterial peptide of Bombyx mori and application thereof, and first proposes application of genes as a regulation target or a regulation marker in improving secretion of antibacterial peptide Gloverin of Bombyx mori, and the application can effectively improve expression of antibacterial peptide Gloverin of Bombyx mori and prolong death time of Bombyx mori infected with nucleopolyhedrovirus by injecting RNAi interference fragments of 7 genes into first-day fifth-instar larvae of Bombyx mori after 6 hours, which provides a new thought for improving expression of antibacterial peptide by taking the like as a molecular target, is favorable for in-depth understanding of a mechanism of Bombyx mori against pathogenic agents, provides a reference for research on Bombyx mori against viruses, and provides a valuable reference for in-depth research on the role of 7 in immune response of Bombyx mori.

This invention discloses an auricular acupressure pellet for treating epileptic seizures, as well as its preparation and usage methods. The auricular acupressure pellet is composed of the following ingredients in the indicated weight percentages: Gastrodia elata 25-35 parts, Fritillaria cirrhosa 25-35 parts, Pinellia ternata 25-35 parts, Poria cocos 25-35 parts, Poria cocos sclerotium 25-35 parts, Bambusa textilis 10-20 parts, Acorus tatarinowii 10-20 parts, Buthus martensii 3-9 parts, Bombyx mori 3-9 parts, Amber 10-20 parts, Uncaria rhynchophylla 10-20 parts, Citrus reticulata 5-12 parts, Polygala tenuifolia 10-15 parts, Salvia miltiorrhiza 25-35 parts, Ophiopogon japonicus 25-35 parts, Margarita 25-35 parts, and Dragon bone 25-35 parts. This invention solves the problems of limited efficacy and inconvenience in use of existing technologies, providing a highly efficient and safe new option for the treatment of epileptic seizures.

To provide a compound of insect origin exhibiting high immunostimulatory activity.SOLUTION: There is provided a polymer compound that is polyethylene glycol or a derivative thereof having an ability to bind to a Toll-like receptor 4.SELECTED DRAWING: None

This invention discloses a strain of *Bacillus parabrachium* ABX1 and its applications, belonging to the field of beneficial microbial technology. The *Bacillus parabrachium* ABX1 provided by this invention is a Gram-positive bacterium isolated from the intestinal fluid of *Bombyx mori*. On CMC-Na solid medium, the ratio of the diameter of the hydrolysis zone to the colony diameter can reach 11. Enzyme activity identification results show that the filter paper enzyme activity of *Bacillus parabrachium* ABX1 is as high as 109.79 U·mL. ‑1 The exo-β-glucanase activity was 107.59 U·mL. ‑1 The cellulase activity reached 107.37 U·mL ‑1 It exhibits excellent cellulose and / or crystalline cellulose degradation capabilities; it is easy to use and has a wide range of enzyme production conditions, showing excellent enzyme activity at pH 5–10 and 25–50℃; the enzyme production time is short, with high enzyme yield achieved in just 12 hours, and there is no significant adverse effect on enzyme yield with prolonged reaction time; it is highly safe to use and has great application prospects in areas such as oak garden waste branch treatment, improvement of oak silkworm digestibility, industrial degradation of cellulose, and improvement of soil fertility.

This invention discloses a flavonoid active ingredient from *Bombyx mori*, its preparation method, and its application in the preparation of antioxidant face masks. Belonging to the field of flavonoid extraction technology, it particularly relates to a method for preparing the flavonoid active ingredient from *Bombyx mori*, comprising: mixing *Bombyx mori* powder with a citrate-sodium citrate buffer solution, adding a complex enzyme for enzymatic hydrolysis to obtain an enzymatically hydrolyzed mixture; adding an ethanol-water solution to the enzymatically hydrolyzed mixture, ultrasonically refluxing to extract, obtaining a preliminary extract; filtering the extract through a filter membrane, concentrating it under reduced pressure to 1 / 4 to 1 / 6 of its original volume to obtain a concentrated solution; purifying with a D101 macroporous adsorption resin, collecting the eluent, and vacuum drying to obtain the flavonoid active ingredient from *Bombyx mori*. The preparation method of this invention has high extraction efficiency and high flavonoid yield of the flavonoid active ingredient from *Bombyx mori*, and its application in the preparation of antioxidant face masks yields a multi-pathway antioxidant network, while also providing moisturizing and soothing functions.

The invention belongs to the technical field of traditional Chinese medicines, and discloses a traditional Chinese medicine composition and a traditional Chinese medicine decoction for treating insomnia, which have obvious curative effects and low toxic and side effects and have obvious curative effects on insomnia and dreaminess, palpitation and restlessness, anxiety and depression, chest and hypochondrium fullness and stuffiness and other symptoms. The traditional Chinese medicine composition is prepared from the following raw medicinal materials in parts by weight: 10-20 parts of radix bupleuri, 5-10 parts of scutellaria baicalensis, 15-20 parts of codonopsis pilosula, 9-15 parts of rhizoma pinelliae preparata, 20-30 parts of poria cocos, 15-30 parts of cassia twig, 10-20 parts of calcined ruddle, 20-30 parts of crude dragon bone, 25-45 parts of raw oyster shell, 15-25 parts of acanthopanax, 15-25 parts of poria with hostwood, 5-10 parts of fried spina date seed, 10-20 parts of honey-fried licorice root, 5-15 parts of stiff silkworm, 6-10 parts of cicada slough, 1-2 parts of scorpion and 10-15 parts of endothelium corneum gigeriae galli. , 10-15 parts of fingered citron, 15-30 parts of dark plum, 20-30 parts of white peony root and 5-15 parts of Chinese magnoliavine fruit. The scorpion is provided in a powder grinding form; the calcined ruddle, the crude dragon bone and the raw oyster shell are decocted with water and then mixed with the other raw medicinal materials, water is added for immersion and decoction for 2-3 times, decoction solutions are combined and mixed uniformly, and the traditional Chinese medicine decoction is obtained. The traditional Chinese medicine composition is prepared from traditional Chinese medicine decoction and scorpion powder.

The invention discloses a traditional Chinese medicine compound formula for disinfecting silkworm rearing bacterial disease pathogens and preparation and application of the traditional Chinese medicine compound formula. Wormwood, dandelion, honeysuckle, golden cypress and radix sophorae flavescentis are mixed to obtain the traditional Chinese medicine compound formula for disinfecting the silkworm rearing bacterial disease pathogens; in the 1-3-year-old silkworm period, the silkworm rearing bed is disinfected once every two days through the spray decoction; in the adult silkworm period of 4-5 years old, the silkworm rearing period of 4 years old and the full feeding period of 5 years old, the dry powder disinfectant is used for disinfecting the silkworm rearing bed once. The invention discloses a traditional Chinese medicine compound formula for disinfecting silkworm rearing bacterial disease pathogens and application of the traditional Chinese medicine compound formula in silkworm breeding, particularly silkworm rearing disinfection for the first time. Silkworm bacterial diseases are common silkworm diseases, chemical drugs are used for disinfection in the prior art, application of silk in the medical beauty industry is limited, different technical thoughts are adopted, wormwood, dandelion, honeysuckle, golden cypress and radix sophorae flavescentis are cooperatively matched, different disinfectant forms in the silkworm period and the adult silkworm period are combined, and the disinfection effect better than that in the prior art is unexpectedly achieved; the application of the silk in the medical beauty industry is not influenced.

The application belongs to the technical field of genetic engineering, and particularly relates to a gRNA targeting Bombyx mori sericin 1 gene, a method for preparing coarse silk and application. The target sequence of the gRNA is shown as SEQ ID NO:1. The method for preparing coarse silk comprises the following steps: 1) constructing a gRNA expression vector targeting the Bombyx mori BmSer1 gene, and preparing a gRNA transgenic Bombyx mori; 2) crossing the gRNA transgenic Bombyx mori and Cas9 transgenic Bombyx mori, and screening to obtain double transgenic individuals with green fluorescence in eyes and bodies; 3) screening to obtain a heterozygous mutant Bombyx mori strain with the BmSer1 gene knocked out through typing detection; and 4) obtaining coarse silk by feeding the transgenic Bombyx mori. The genetic editing technology is used to change the genetic traits of Bombyx mori, and the obtained silk has a larger diameter, a lower sericin rate, better water resistance and durability.

The invention discloses a frozen bombyx mori preparation method and a method for breeding cantheconidea furcellata by using frozen bombyx mori. The frozen bombyx mori preparation method comprises the following steps: S1, selecting 3-age, 4-age and / or 5-age 1-3-day bombyx mori; s2, a mixed aqueous solution A containing ascorbic acid and trehalose is evenly sprayed on the mulberry leaves, and the mulberry leaves are aired and then fed to silkworms; s3, the silkworms fed with the mulberry leaves are soaked in hot water to be blanched for 10-30 seconds, the silkworms are rapidly placed in a mixed aqueous solution B containing magnesium ascorbyl phosphate and trehalose to be soaked for 10-15 minutes, the silkworms are fished out and drained, the silkworms are placed at the temperature of-20 DEG C to be frozen and stored for use, and the frozen silkworms are obtained. After being frozen, the silkworms are used for feeding cantheconidea furcellatus, so that the silkworms are not limited by silkworm breeding seasons, are convenient to store, are convenient to eat by the cantheconidea furcellatus at all ages, do not need to additionally place a water replenishing device, and reduce feeding links; the method has the advantages that the survival rate of cantheconidea furcellata nymphs and adults can be greatly increased, the egg laying period is prolonged, the egg laying amount is increased, and cantheconidea furcellata breed conservation in winter is facilitated.

The application discloses a breeding method of a bivoltine silkworm variety stably expressing a Cas9-gfp fusion protein and application, the method takes a multivoltine silkworm variety Nistari-Cas9gfp stably expressing a Cas9-gfp fusion protein as a female parent, a bivoltine silkworm as a male parent, and a F1 generation is obtained by hybridization; the F1 generation is backcrossed with the bivoltine silkworm to obtain a BC1 generation, the BC1 generation is sidecrossed with the Nistari-Cas9gfp silkworm, and the corresponding egg ring of the moth with green fluorescence is screened after rearing and subculturing; when economic traits are the same as those of the bivoltine male parent, a homozygous individual is selected by self-crossing.Compared with the prior art, the method has the advantages that (1) the method breeds the bivoltine silkworm variety capable of efficiently and stably expressing the Cas9-gfp fusion protein, so that the variety emits green fluorescence with a wavelength of 506nm under the excitation of light with a wavelength of 496nm; and (2) the method plays an important role in analyzing the diapause regulation molecular mechanism of the silkworm, gene function and excellent practical variety cultivation.

The invention relates to a method for inferring a silkworm chrysalis stage development process based on trimethyl lysine hydroxylase. The method comprises the following steps: (1) constructing a correlation model of relative transcription expression quantity of a trimethyl lysine hydroxylase gene and a reference gene of a silkworm chrysalis sample of a variety to be detected and pupal stage development time; and (2) determining the relative transcription expression quantity of the trimethyl lysine hydroxylase and the reference gene in the silkworm chrysalis to be detected, and calculating the pupal stage development time according to the correlation model obtained in the step (1). According to the method, the development process of one or more silkworm chrysalis can be accurately measured, errors caused by traditional visual inspection can be reduced, a new detection method is provided for deducing the pupal development process of the silkworms, and an important basis is provided for judging moth formation time in silkworm seed production work.

The application discloses a silkworm humidity self-adjusting breeding box, which comprises a breeding box main body, the breeding box main body comprises an outer box, an inner box arranged in the inner side of the outer box, a box cover rotationally connected with the outer box, a gauze tray is arranged in the middle of the inner box based on a support table, a water absorption sponge is arranged at the bottom of the gauze tray based on a support frame, evaporation holes are uniformly arranged on the surface of the water absorption sponge, a water outlet is arranged at the bottom of the inner box, a drain pipe is arranged at the water outlet and extends to the outside of the outer box, a water storage box is arranged on the side wall of the outer box, the water storage box supplies water to the water absorption sponge based on a water guide pipe, and the water guide pipe comprises a hose and a water guide cotton line arranged in the hose. The capillary action and the water absorption sponge continuously supply water into the breeding box, the ventilation gap guarantees the diffusion of moisture, the silkworms are separated from the excrement, and the silkworms are prevented from being hurt when the silkworms are picked and sorted during cleaning. The breeding box is simple in operation, ensures the stable growth environment of the silkworms, is suitable for small and medium-sized breeding farms and family breeding scenes, and has the advantages of practicability and economy.

The invention discloses a pill formula for treating epilepsy and a preparation method thereof, and relates to the technical field of traditional Chinese medicine preparations, in particular to a pill formula for treating epilepsy and a preparation method thereof. The medicine is prepared from the following twenty medicinal material powder and auxiliary materials: 14-16 parts of radix bupleuri, 11-13 parts of coptis chinensis, 11-13 parts of mirabilite, 14-16 parts of fructus aurantii, 10-11 parts of gastrodia elata, 11-13 parts of platycodon grandiflorum, 11-13 parts of pinellia ternate, 11-13 parts of tabasheer, 4-5 parts of liquorice, 14-16 parts of pericarpium citri reticulatae, 11-13 parts of cape jasmine, 14-16 parts of poria with hostwood, 21-23 parts of bombyx batryticatus, 11-13 parts of radix saposhnikoviae, 14-16 parts of uncaria rhynchophylla, 11-13 parts of arisaema cum bile, 4-6 parts of scorpio, 14-16 parts of white antelope horn powder and 100-110 parts of According to the traditional Chinese medicine composition, the curative effect and safety are remarkably improved.

The invention relates to the technical field of biological breeding, and discloses a crossbreeding method of disease-resistant silkworms. The crossbreeding method comprises the following steps: screening crossbreeding parents of the disease-resistant silkworms, stabilizing the characters of the screened disease-resistant parents of Chinese and Japanese silkworms, and hybridizing the disease-resistant parents of the silkworms after the characters are stabilized, so that the stability of the midgut pyosis resistance characters of the silkworms is improved. According to the midgut-pyosis-resistant bombyx mori obtained by the crossbreeding method of the disease-resistant bombyx mori disclosed by the invention, the resistance of the bombyx mori to midgut-pyosis viruses is successfully improved on the basis of ensuring the practicability. In addition, the cross breeding method disclosed by the invention is simple and high in operability, and breeding can be realized only through hybridization.

The invention discloses application of knockout or silencing bombyx mori olfaction receptor genes BmOr39 or BmOrJ in creation of a bombyx mori euryphagous strain, the bombyx mori olfaction receptor genes BmOr39 and BmOrJ are targeted, genetic modification operation is performed on the bombyx mori olfaction receptor genes BmOr39 and BmOrJ, and the expression quantity and protein products of the genes are changed, so that the special feeding property of bombyx mori to mulberry leaves is changed, and the bombyx mori euryphagous strain is created. Therefore, the feeding intake and adaptability to artificial feed are obviously enhanced. Gene target points BmOr39 and BmOrJ genes for obtaining the eurytopic bombyx mori variety are provided, the BmOr39, BmOrJ and BmGr66 three-gene knockout bombyx mori strain is prepared, the artificial feed intake and adaptability of the bombyx mori strain are remarkably improved, and the bombyx mori strain is beneficial to solving the eurytopic problem and breeding and production application of the bombyx mori variety with excellent adaptability to the artificial feed.

The pharmaceutical use of the drug of the application is the pharmaceutical use of the broad-spectrum RNA virus drug of the application, i.e. the pharmaceutical use of the drug of the application in the treatment of the silkworm midgut type pyosis BmCPV. The drug of the application is dissolved in DMSO, and the concentration is 17.5 mg / mL. The drug of the application can inhibit the expression of the BmCPV S1 gene, and the treatment effect of the silkworm midgut type pyosis can be achieved. And the drug of the application can be continuously administered according to the dosage of the application, and the silkworm will not be negatively affected.

The invention discloses an external nursing cream containing white muscardine silkworm and gentiana macrophylla and a preparation method thereof, the nursing cream takes white muscardine silkworm and gentiana macrophylla as main raw materials, the main raw materials are extracted by ethanol with the concentration of 20-99%, and the ethanol can be edible wine, health care medicinal liquor or medical ethanol; and the finished product is mild for external use after being blended by a matrix, and the irritation is controllable. Auxiliary materials such as artificial musk, ground beeltle, mirabilite, myrrh and angelica sinensis can be selectively added, and the ointment is prepared by extracting, concentrating and adding an external matrix. The invention has the advantages of simple and mild formula, flexible and simple process, easily available raw materials and wide application range, and is suitable for daily external skin care.

This invention belongs to the field of food fermentation, specifically relating to a type of rice wine with high antioxidant capacity, its preparation method, and the bacteria used. This invention provides a rope-shaped basket-shaped fungus (…). Talaromyces funiculosus The specimen, 7-2-B3-1, has the accession number CGMCC No. 41921. This invention also provides a method for preparing a high-antioxidant rice wine, in which *Bombyx mori* (a type of fungus) is used during the saccharification process. Talaromyces funiculosu s) 7-2-B3-1 culture medium. Using the method of this invention, rice wine with excellent antioxidant properties can be obtained; and the fermentation time is short.

This invention relates to the field of traditional Chinese medicine (TCM) technology, specifically to a TCM composition for treating rheumatoid arthritis and its application. The TCM composition comprises the following raw materials: mulberry twigs, Gentiana macrophylla, Phellodendron chinense, earthworm, stir-fried Arctium lappa, Achyranthes bidentata, stir-fried Bombyx mori, Lonicera japonica, and Spatholobus suberectus. This TCM composition can reduce arthritis scores and paw volume in rats with rheumatoid arthritis, reduce the spleen coefficient in rats with rheumatoid arthritis, significantly reduce TNF-α, IL-6, and IL-1β in rat serum, improve joint inflammation, and has no toxic side effects. This indicates that the TCM composition for treating rheumatoid arthritis in this application can alleviate symptoms in patients with rheumatoid arthritis, exert its anti-inflammatory and analgesic effects, and thus treat rheumatoid arthritis.

The invention discloses diatom rice protein feed as well as a preparation method and application thereof, and belongs to the technical field of animal breeding. The diatom rice protein feed comprises a component A, a component B and a component C, the component A comprises glutinous rice, rice, rice bran, sweet distiller's yeast, arrack distiller's yeast, beer yeast, dry yeast powder, fresh malt, diatom powder and phyllostachys pubescens powder; the component B comprises Xuefeng cordyceps fungus, silkworm fungus, astragalus membranaceus, liquorice, codonopsis pilosula, caulis spatholobi, folium isatidis powder and mulberry leaf powder, and the component C comprises rice, fresh papaya juice, walnut powder, edible soda ash, salt, loach mucus or catfish mucus, brown sugar and banana jam. The diatom and rice protein feed disclosed by the invention is rich in nutrition, high in grade, simple in process, low in raw material cost, production cost and energy consumption cost, very wide in application way and good in market prospect.

The invention discloses a primer pair, a probe and a reagent set for detecting bombyx mori densovirus and a preparation method of the primer pair, the probe and the reagent set, and relates to the technical field of biology. According to the primer pair for detecting the bombyx mori densovirus, the nucleotide sequence of an upstream primer of the primer pair is CTACGGGAGGCTTGTTGGTT; and the nucleotide sequence of the downstream primer is ACTTACCATTGGTTATAAGGGTG. The invention further discloses a probe for detecting the bombyx mori densovirus and application of the probe. A complete set of reagents for detecting BmBDV infection is established based on a real-time fluorescent quantitative PCR technology, and redundant operation generated when a detection system is configured can be effectively reduced through a preset primer pair and a probe.

This invention discloses a traditional Chinese medicine composition for pulmonary nodules and its preparation method. The composition is prepared from the following components in parts by weight: 6-30 parts raw oyster shell, 3-15 parts Scrophularia ningpoensis, 3-15 parts Fritillaria thunbergii, 2-10 parts Uncaria rhynchophylla, 3-15 parts vinegar-processed turtle shell, 3-15 parts stir-fried Bombyx mori, 2-10 parts stir-fried mustard seed, 2-10 parts processed Pinellia ternata, 3-15 parts Codonopsis pilosula, 2-10 parts vinegar-processed Curcuma zedoaria, 3-15 parts Rhodiola rosea, 2-10 parts bee honeycomb, 6-30 parts lily bulb, 3-15 parts dried plum, 3-15 parts Ganoderma lucidum, 2-10 parts stir-fried bitter almond, 3-15 parts honey-processed mulberry bark, and 2-10 parts Scutellaria baicalensis. This invention has the functions of resolving phlegm and removing blood stasis, attacking toxins and dispersing nodules, invigorating qi and promoting qi circulation, and nourishing yin and moistening the lungs. It is used in medicines and health products for pulmonary nodules.

One aspect provides a pharmaceutical composition for the prevention or treatment of non-alcoholic fatty liver disease, comprising a Bombyx mori powder and / or a silk fibroin-derived peptide, wherein 0.005 g / kg to 0.2 g / kg of a Bombyx mori powder is administered, and 10 μg / mL to 200 μg / mL of a silk fibroin-derived peptide is administered. The Bombyx mori powder and / or the silk fibroin-derived peptide, according to one aspect, reduces fat accumulation in the liver, increases fatty acid oxidation, and moreover, significantly reduces liver inflammation caused by non-alcoholic fatty liver. That is, the Bombyx mori powder and / or the silk fibroin-derived peptide exhibits a notably excellent effect in the prevention, alleviation, or treatment of fatty liver and thus may be effectively used as a novel therapeutic agent for non-alcoholic fatty liver disease.

The utility model relates to the technical field of bombyx mori breeding, in particular to a bombyx mori artificial feed spreading machine capable of loading materials circularly, which comprises a fixing frame, a sliding groove is formed in the top of the fixing frame, a movable sleeve is arranged in the sliding groove, a material containing hopper used for storing artificial feed is placed in the movable sleeve, and a discharge port is formed in the bottom of the fixing frame. The discharging opening is communicated with the sliding groove; in the descending process of the containing hopper, the top of an ejector rod is matched with two supporting rods, two overturning plates are pushed to rotate, the artificial feed in the containing hopper penetrates through a discharging opening and a discharging opening, meanwhile, the extending end of an air cylinder is controlled to stretch out and draw back in a reciprocating mode, the artificial feed is laid in a silkworm box in a reciprocating mode, the manual laying process is avoided, and the laying efficiency is improved. Not only is the labor intensity of breeding the silkworms reduced, but also the artificial feed is uniformly laid, and the normal development of the silkworms is ensured; when the artificial feed in the hopper is completely put, another hopper filled with the artificial feed is replaced, the process is easy and convenient to operate, and laying of the artificial feed is accelerated.

This invention discloses a multi-level ecological polyculture method for *Bombyx mori*, comprising the following steps: S1, pond treatment; S2, aquatic plant planting; S3, snail seedling selection and stocking; S4, *Cyprinus cuspidatus* selection and stocking; S5, feeding; S6, water quality control; S7, harvesting. This invention, by polyculturing *Bombyx mori* and *Cyprinus cuspidatus*, can fully utilize feed and water resources, providing an excellent aquatic environment for *Cyprinus cuspidatus* while significantly increasing the yield and survival rate of *Bombyx mori* per unit water volume, thus bringing good economic value.

The utility model relates to the technical field of agricultural insect experiment auxiliary devices, and particularly discloses a silkworm living body shooting auxiliary device which comprises a plate storage groove, a cold supply groove, scale plates and a drawer box, one side of the plate storage groove is fixedly connected with one side of the cold supply groove, and a plurality of scale plates with different colors are placed in the plate storage groove. The drawer box is installed in the cold supply groove in a sliding mode, a cold source is placed in the drawer box, the scale plate is detachably placed above the drawer box, and scales used for measuring bombyx mori are arranged on the scale plate. According to the living silkworm shooting auxiliary device, the silkworms are quiet, convenient to shoot and free of chemical stimulation through low temperature, the natural physiological state of the silkworms is kept, and the accuracy of measurement results is ensured.

This invention relates to the field of biomedicine. It provides a compound astragalus and ganoderma preparation with anti-cancer properties, its preparation method, and its application. The preparation is made from the following raw materials in parts by weight: 200-500 parts ganoderma, 200-500 parts astragalus, 50-100 parts ganoderma spore powder, 30-60 parts Panax notoginseng, 30-60 parts Salvia miltiorrhiza, 50-100 parts Atractylodes macrocephala, 150-300 parts Smilax glabra, 100-200 parts Hedyotis diffusa, 20-40 parts Bombyx mori, and 20-40 parts Glycyrrhiza uralensis. The compound astragalus and ganoderma preparation of this invention has anti-tumor effects and improves the effects of radiotherapy and chemotherapy on leukopenia and thrombocytopenia, as well as adverse reactions caused by anti-tumor treatment.