34 results about "Bombyx mori" patented technology

The invention discloses application of bombyx mori chemosensory protein BmCSP4 and a method for breeding bombyx mori varieties, and relates to the technical field of biology, the application of the bombyx mori chemosensory protein BmCSP4 is used for breeding high-yield bombyx mori varieties, the nucleotide sequence of the BmCSP4 is shown as SEQ ID NO.16, and the high yield refers to increase of pupa weight or increase of cocoon shell weight. The transgenic bombyx mori provided by the invention shows obvious individual development advantages, and related economic characters, such as transgenic overexpressed bombyx mori female and male average pupa weights, are respectively improved by 9.94% and 8.36% compared with wild type bombyx mori; and the average cocoon weights of female and male transgenic overexpressed bombyx mori are respectively improved by 8.49% and 17.2% compared with those of wild type bombyx mori.

This invention discloses an auricular acupressure pellet for treating epileptic seizures, as well as its preparation and usage methods. The auricular acupressure pellet is composed of the following ingredients in the indicated weight percentages: Gastrodia elata 25-35 parts, Fritillaria cirrhosa 25-35 parts, Pinellia ternata 25-35 parts, Poria cocos 25-35 parts, Poria cocos sclerotium 25-35 parts, Bambusa textilis 10-20 parts, Acorus tatarinowii 10-20 parts, Buthus martensii 3-9 parts, Bombyx mori 3-9 parts, Amber 10-20 parts, Uncaria rhynchophylla 10-20 parts, Citrus reticulata 5-12 parts, Polygala tenuifolia 10-15 parts, Salvia miltiorrhiza 25-35 parts, Ophiopogon japonicus 25-35 parts, Margarita 25-35 parts, and Dragon bone 25-35 parts. This invention solves the problems of limited efficacy and inconvenience in use of existing technologies, providing a highly efficient and safe new option for the treatment of epileptic seizures.

This invention discloses a strain of *Bacillus parabrachium* ABX1 and its applications, belonging to the field of beneficial microbial technology. The *Bacillus parabrachium* ABX1 provided by this invention is a Gram-positive bacterium isolated from the intestinal fluid of *Bombyx mori*. On CMC-Na solid medium, the ratio of the diameter of the hydrolysis zone to the colony diameter can reach 11. Enzyme activity identification results show that the filter paper enzyme activity of *Bacillus parabrachium* ABX1 is as high as 109.79 U·mL. ‑1 The exo-β-glucanase activity was 107.59 U·mL. ‑1 The cellulase activity reached 107.37 U·mL ‑1 It exhibits excellent cellulose and / or crystalline cellulose degradation capabilities; it is easy to use and has a wide range of enzyme production conditions, showing excellent enzyme activity at pH 5–10 and 25–50℃; the enzyme production time is short, with high enzyme yield achieved in just 12 hours, and there is no significant adverse effect on enzyme yield with prolonged reaction time; it is highly safe to use and has great application prospects in areas such as oak garden waste branch treatment, improvement of oak silkworm digestibility, industrial degradation of cellulose, and improvement of soil fertility.

This invention discloses a flavonoid active ingredient from *Bombyx mori*, its preparation method, and its application in the preparation of antioxidant face masks. Belonging to the field of flavonoid extraction technology, it particularly relates to a method for preparing the flavonoid active ingredient from *Bombyx mori*, comprising: mixing *Bombyx mori* powder with a citrate-sodium citrate buffer solution, adding a complex enzyme for enzymatic hydrolysis to obtain an enzymatically hydrolyzed mixture; adding an ethanol-water solution to the enzymatically hydrolyzed mixture, ultrasonically refluxing to extract, obtaining a preliminary extract; filtering the extract through a filter membrane, concentrating it under reduced pressure to 1 / 4 to 1 / 6 of its original volume to obtain a concentrated solution; purifying with a D101 macroporous adsorption resin, collecting the eluent, and vacuum drying to obtain the flavonoid active ingredient from *Bombyx mori*. The preparation method of this invention has high extraction efficiency and high flavonoid yield of the flavonoid active ingredient from *Bombyx mori*, and its application in the preparation of antioxidant face masks yields a multi-pathway antioxidant network, while also providing moisturizing and soothing functions.

The invention belongs to the technical field of traditional Chinese medicines, and discloses a traditional Chinese medicine composition and a traditional Chinese medicine decoction for treating insomnia, which have obvious curative effects and low toxic and side effects and have obvious curative effects on insomnia and dreaminess, palpitation and restlessness, anxiety and depression, chest and hypochondrium fullness and stuffiness and other symptoms. The traditional Chinese medicine composition is prepared from the following raw medicinal materials in parts by weight: 10-20 parts of radix bupleuri, 5-10 parts of scutellaria baicalensis, 15-20 parts of codonopsis pilosula, 9-15 parts of rhizoma pinelliae preparata, 20-30 parts of poria cocos, 15-30 parts of cassia twig, 10-20 parts of calcined ruddle, 20-30 parts of crude dragon bone, 25-45 parts of raw oyster shell, 15-25 parts of acanthopanax, 15-25 parts of poria with hostwood, 5-10 parts of fried spina date seed, 10-20 parts of honey-fried licorice root, 5-15 parts of stiff silkworm, 6-10 parts of cicada slough, 1-2 parts of scorpion and 10-15 parts of endothelium corneum gigeriae galli. , 10-15 parts of fingered citron, 15-30 parts of dark plum, 20-30 parts of white peony root and 5-15 parts of Chinese magnoliavine fruit. The scorpion is provided in a powder grinding form; the calcined ruddle, the crude dragon bone and the raw oyster shell are decocted with water and then mixed with the other raw medicinal materials, water is added for immersion and decoction for 2-3 times, decoction solutions are combined and mixed uniformly, and the traditional Chinese medicine decoction is obtained. The traditional Chinese medicine composition is prepared from traditional Chinese medicine decoction and scorpion powder.

The invention discloses a traditional Chinese medicine compound formula for disinfecting silkworm rearing bacterial disease pathogens and preparation and application of the traditional Chinese medicine compound formula. Wormwood, dandelion, honeysuckle, golden cypress and radix sophorae flavescentis are mixed to obtain the traditional Chinese medicine compound formula for disinfecting the silkworm rearing bacterial disease pathogens; in the 1-3-year-old silkworm period, the silkworm rearing bed is disinfected once every two days through the spray decoction; in the adult silkworm period of 4-5 years old, the silkworm rearing period of 4 years old and the full feeding period of 5 years old, the dry powder disinfectant is used for disinfecting the silkworm rearing bed once. The invention discloses a traditional Chinese medicine compound formula for disinfecting silkworm rearing bacterial disease pathogens and application of the traditional Chinese medicine compound formula in silkworm breeding, particularly silkworm rearing disinfection for the first time. Silkworm bacterial diseases are common silkworm diseases, chemical drugs are used for disinfection in the prior art, application of silk in the medical beauty industry is limited, different technical thoughts are adopted, wormwood, dandelion, honeysuckle, golden cypress and radix sophorae flavescentis are cooperatively matched, different disinfectant forms in the silkworm period and the adult silkworm period are combined, and the disinfection effect better than that in the prior art is unexpectedly achieved; the application of the silk in the medical beauty industry is not influenced.

The application belongs to the technical field of genetic engineering, and particularly relates to a gRNA targeting Bombyx mori sericin 1 gene, a method for preparing coarse silk and application. The target sequence of the gRNA is shown as SEQ ID NO:1. The method for preparing coarse silk comprises the following steps: 1) constructing a gRNA expression vector targeting the Bombyx mori BmSer1 gene, and preparing a gRNA transgenic Bombyx mori; 2) crossing the gRNA transgenic Bombyx mori and Cas9 transgenic Bombyx mori, and screening to obtain double transgenic individuals with green fluorescence in eyes and bodies; 3) screening to obtain a heterozygous mutant Bombyx mori strain with the BmSer1 gene knocked out through typing detection; and 4) obtaining coarse silk by feeding the transgenic Bombyx mori. The genetic editing technology is used to change the genetic traits of Bombyx mori, and the obtained silk has a larger diameter, a lower sericin rate, better water resistance and durability.

The application discloses a breeding method of a bivoltine silkworm variety stably expressing a Cas9-gfp fusion protein and application, the method takes a multivoltine silkworm variety Nistari-Cas9gfp stably expressing a Cas9-gfp fusion protein as a female parent, a bivoltine silkworm as a male parent, and a F1 generation is obtained by hybridization; the F1 generation is backcrossed with the bivoltine silkworm to obtain a BC1 generation, the BC1 generation is sidecrossed with the Nistari-Cas9gfp silkworm, and the corresponding egg ring of the moth with green fluorescence is screened after rearing and subculturing; when economic traits are the same as those of the bivoltine male parent, a homozygous individual is selected by self-crossing.Compared with the prior art, the method has the advantages that (1) the method breeds the bivoltine silkworm variety capable of efficiently and stably expressing the Cas9-gfp fusion protein, so that the variety emits green fluorescence with a wavelength of 506nm under the excitation of light with a wavelength of 496nm; and (2) the method plays an important role in analyzing the diapause regulation molecular mechanism of the silkworm, gene function and excellent practical variety cultivation.

The pharmaceutical use of the drug of the application is the pharmaceutical use of the broad-spectrum RNA virus drug of the application, i.e. the pharmaceutical use of the drug of the application in the treatment of the silkworm midgut type pyosis BmCPV. The drug of the application is dissolved in DMSO, and the concentration is 17.5 mg / mL. The drug of the application can inhibit the expression of the BmCPV S1 gene, and the treatment effect of the silkworm midgut type pyosis can be achieved. And the drug of the application can be continuously administered according to the dosage of the application, and the silkworm will not be negatively affected.

The invention discloses an external nursing cream containing white muscardine silkworm and gentiana macrophylla and a preparation method thereof, the nursing cream takes white muscardine silkworm and gentiana macrophylla as main raw materials, the main raw materials are extracted by ethanol with the concentration of 20-99%, and the ethanol can be edible wine, health care medicinal liquor or medical ethanol; and the finished product is mild for external use after being blended by a matrix, and the irritation is controllable. Auxiliary materials such as artificial musk, ground beeltle, mirabilite, myrrh and angelica sinensis can be selectively added, and the ointment is prepared by extracting, concentrating and adding an external matrix. The invention has the advantages of simple and mild formula, flexible and simple process, easily available raw materials and wide application range, and is suitable for daily external skin care.

This invention relates to the field of traditional Chinese medicine (TCM) technology, specifically to a TCM composition for treating rheumatoid arthritis and its application. The TCM composition comprises the following raw materials: mulberry twigs, Gentiana macrophylla, Phellodendron chinense, earthworm, stir-fried Arctium lappa, Achyranthes bidentata, stir-fried Bombyx mori, Lonicera japonica, and Spatholobus suberectus. This TCM composition can reduce arthritis scores and paw volume in rats with rheumatoid arthritis, reduce the spleen coefficient in rats with rheumatoid arthritis, significantly reduce TNF-α, IL-6, and IL-1β in rat serum, improve joint inflammation, and has no toxic side effects. This indicates that the TCM composition for treating rheumatoid arthritis in this application can alleviate symptoms in patients with rheumatoid arthritis, exert its anti-inflammatory and analgesic effects, and thus treat rheumatoid arthritis.

The invention discloses a primer pair, a probe and a reagent set for detecting bombyx mori densovirus and a preparation method of the primer pair, the probe and the reagent set, and relates to the technical field of biology. According to the primer pair for detecting the bombyx mori densovirus, the nucleotide sequence of an upstream primer of the primer pair is CTACGGGAGGCTTGTTGGTT; and the nucleotide sequence of the downstream primer is ACTTACCATTGGTTATAAGGGTG. The invention further discloses a probe for detecting the bombyx mori densovirus and application of the probe. A complete set of reagents for detecting BmBDV infection is established based on a real-time fluorescent quantitative PCR technology, and redundant operation generated when a detection system is configured can be effectively reduced through a preset primer pair and a probe.

This invention discloses a traditional Chinese medicine composition for pulmonary nodules and its preparation method. The composition is prepared from the following components in parts by weight: 6-30 parts raw oyster shell, 3-15 parts Scrophularia ningpoensis, 3-15 parts Fritillaria thunbergii, 2-10 parts Uncaria rhynchophylla, 3-15 parts vinegar-processed turtle shell, 3-15 parts stir-fried Bombyx mori, 2-10 parts stir-fried mustard seed, 2-10 parts processed Pinellia ternata, 3-15 parts Codonopsis pilosula, 2-10 parts vinegar-processed Curcuma zedoaria, 3-15 parts Rhodiola rosea, 2-10 parts bee honeycomb, 6-30 parts lily bulb, 3-15 parts dried plum, 3-15 parts Ganoderma lucidum, 2-10 parts stir-fried bitter almond, 3-15 parts honey-processed mulberry bark, and 2-10 parts Scutellaria baicalensis. This invention has the functions of resolving phlegm and removing blood stasis, attacking toxins and dispersing nodules, invigorating qi and promoting qi circulation, and nourishing yin and moistening the lungs. It is used in medicines and health products for pulmonary nodules.

One aspect provides a pharmaceutical composition for the prevention or treatment of non-alcoholic fatty liver disease, comprising a Bombyx mori powder and / or a silk fibroin-derived peptide, wherein 0.005 g / kg to 0.2 g / kg of a Bombyx mori powder is administered, and 10 μg / mL to 200 μg / mL of a silk fibroin-derived peptide is administered. The Bombyx mori powder and / or the silk fibroin-derived peptide, according to one aspect, reduces fat accumulation in the liver, increases fatty acid oxidation, and moreover, significantly reduces liver inflammation caused by non-alcoholic fatty liver. That is, the Bombyx mori powder and / or the silk fibroin-derived peptide exhibits a notably excellent effect in the prevention, alleviation, or treatment of fatty liver and thus may be effectively used as a novel therapeutic agent for non-alcoholic fatty liver disease.

The utility model relates to the technical field of agricultural insect experiment auxiliary devices, and particularly discloses a silkworm living body shooting auxiliary device which comprises a plate storage groove, a cold supply groove, scale plates and a drawer box, one side of the plate storage groove is fixedly connected with one side of the cold supply groove, and a plurality of scale plates with different colors are placed in the plate storage groove. The drawer box is installed in the cold supply groove in a sliding mode, a cold source is placed in the drawer box, the scale plate is detachably placed above the drawer box, and scales used for measuring bombyx mori are arranged on the scale plate. According to the living silkworm shooting auxiliary device, the silkworms are quiet, convenient to shoot and free of chemical stimulation through low temperature, the natural physiological state of the silkworms is kept, and the accuracy of measurement results is ensured.

This invention relates to the field of biomedicine. It provides a compound astragalus and ganoderma preparation with anti-cancer properties, its preparation method, and its application. The preparation is made from the following raw materials in parts by weight: 200-500 parts ganoderma, 200-500 parts astragalus, 50-100 parts ganoderma spore powder, 30-60 parts Panax notoginseng, 30-60 parts Salvia miltiorrhiza, 50-100 parts Atractylodes macrocephala, 150-300 parts Smilax glabra, 100-200 parts Hedyotis diffusa, 20-40 parts Bombyx mori, and 20-40 parts Glycyrrhiza uralensis. The compound astragalus and ganoderma preparation of this invention has anti-tumor effects and improves the effects of radiotherapy and chemotherapy on leukopenia and thrombocytopenia, as well as adverse reactions caused by anti-tumor treatment.

This invention relates to a topical tincture for treating psoriasis and its preparation method. The herbal formula comprises: 16-36 parts by weight of Psoralea corylifolia, 2-6 parts by weight of Cinnamomum cassia, 18-41 parts by weight of Zaocys dhumnades, 9-20 parts by weight of Bombyx mori excrement, and 9-20 parts by weight of Angelica dahurica. The above herbal formula is prepared as a tincture using 75% alcohol. Based on traditional empirical formulas and combined with the clinical symptoms of psoriasis in Traditional Chinese Medicine, this invention selects suitable herbs with photosensitive components. The formula exhibits good drug compatibility and interactions, and can be used independently or in combination with natural sunlight or ultraviolet radiation, greatly improving efficacy.

The invention discloses an application of an ILRUN gene in regulation and control of bombyx mori wing scale quantity. The invention firstly proposes and verifies that the inflammation with UBA-like and NBR1-like structural domains is inhibited, and the lipid regulatory factor gene ILRUN can reduce the wing scale amount of the silkworm adult. Based on the sgRNA provided by the invention, ILRUN gene knockout can be effectively realized, and the sgRNA can be used for actual production and construction of a'low moth grey 'silkworm variety.

The application belongs to the technical field of traditional Chinese medicines, and particularly relates to a traditional Chinese medicine composition for treating phlegm turbidity blocking type hyperuricemia, a preparation method and application thereof. The traditional Chinese medicine composition is prepared from Alisma orientalis (Sam.) Juzep, Atractylodes macrocephala Koidz, Lonicera japonica Thunb, Smilax glabra, corn silk, Salvia miltiorrhiza Bunge, Portulaca oleracea L, Bombyx mori, Angelica sinensis, Cinnamomum cassia, and Tripterygium regelii, and has the effects of eliminating phlegm, reducing turbidity and dredging joints. The traditional Chinese medicine has a wide source, can be prepared into 5g / pack concentrated pills, is convenient to use, low in price, good in curative effect, small in toxic and side effects during the taking process of patients, and can regulate the body constitution of patients from the whole concept, and the total effective rate can reach 93.2%.

The invention discloses a preparation method of an abelmoschus manihot composition psoriasis external ointment, and relates to the technical field of psoriasis ointment preparation. Comprising the following steps: raw material compatibility and pretreatment: taking 10-30 parts by mass of abelmoschus manihot, 8-20 parts by mass of salvia miltiorrhiza, 5-15 parts by mass of gentiana macrophylla, 5-15 parts by mass of fried stiff silkworm, 5-15 parts by mass of ginseng, 1-5 parts by mass of prepared cantharides, 2-8 parts by mass of camphor crystals, 2-8 parts by mass of borneol, 3-10 parts by mass of mint crystals, 20-40 parts by mass of pure mutton fat and 10-30 parts by mass of olive oil. The borneol is guided into the skin, and all the medicinal materials have a synergistic effect and have a treatment effect on multiple links such as inflammation, hyperplasia and pruritus of psoriasis; a superfine grinding technology is adopted, so that the dissolution rate of effective components is greatly improved; the extraction efficiency is ensured and the loss of volatile components is avoided by adopting a segmented cooking process; the uniformity and the stability of the ointment are ensured by programmed cooling; the pure mutton fat and the olive oil are used as substrates, so that the skin affinity and the permeability are good.

The invention discloses a bombyx mori SNP molecular marker combination, a chip and application of the bombyx mori SNP molecular marker combination. Comprising 5,381 SNP molecular markers, and the physical positions of the 5,381 SNP molecular markers are determined by sequence alignment based on a bombyx mori reference genome GCA030269925.2. The SNP loci in the silkworm SNP molecular marker combination are screened based on 120 collected varieties of Henan province silkworms with rich diversity, are strong in representativeness, high in polymorphism, good in universality, high in coverage rate on genome and uniform in distribution, can effectively distinguish different silkworm varieties, and are more suitable for local varieties of Henan province silkworms.

The invention discloses a traditional Chinese medicine nano composition as well as a preparation method and application thereof, and relates to the technical field of traditional Chinese medicine preparations. The preparation method comprises the following steps: mixing the traditional Chinese medicine raw materials according to the formula ratio, soaking with water, decocting, and filtering with gauze to obtain filtrate; performing differential centrifugation on the filtrate, and taking supernatant; carrying out ultracentrifugation on the supernatant and then taking a precipitate; and resuspending the precipitate with water to obtain the traditional Chinese medicine nano composition. Wherein the traditional Chinese medicine raw materials comprise radix bupleuri, pinellia ternate, codonopsis pilosula, liquorice, scutellaria baicalensis, ginger, jujube, ephedra, cassia twig, radix paeoniae alba, asarum, schisandra chinensis, rhizoma zingiberis, periostracum cicada, stiff silkworm, turmeric, rheum officinale and solidago decurrens. The traditional Chinese medicine nano composition provided by the invention is scientific in compatibility, has the effects of eliminating evil and strengthening the body resistance, not only aims at exterior syndromes of exogenous wind-cold and internal water retention, but also recuperates a shaoyang central machine and reconciles qi activity, realizes the comprehensive curative effects of relieving exterior and interior, regulating cold and heat and treating qi and blood simultaneously, and has remarkable treatment advantages on respiratory tract infectious diseases such as seasonal influenza.

The invention discloses a pharmaceutical composition for prolonging life and preserving health. The traditional Chinese medicine composition comprises the following components: prepared rehmannia root, polygonum multiflorum, herba epimedii, male silkworm moth, schisandra chinensis, tribulus terrestris, dried ginger, angelica sinensis, bighead atractylodes rhizome, liquorice, cistanche, rhizoma cibotii, pseudo-ginseng, winter wheat, dendrobe, pericarpium citri reticulatae, glossy privet fruit, poria cocos, eucommia ulmoides, ligusticum chuanxiong hort, rhizoma alismatis, cudweed, lily, tendril-leaved fritillary bulb, rhizoma anemarrhenae, spina date seed, coix seed, medicated leaven, astragalus membranaceus, morinda officinalis, endothelium corneum gigeriae galli, musk, raspberry, codonopsis pilosula, phellinus igniarius, gecko, scorpion and ground beetle. A femtosecond wall breaking technology is combined with an ancient processing method, and medicated leaven is used for double fermentation, so that the medicine effect is improved by 8-10 times; the antioxidant capacity of the body can be improved, free radicals, immune functions and nerve protection functions are eliminated, and senescence is delayed; the medicine can treat old and chronic diseases. The preparation forms comprise decoction, oral liquid, pills and medicinal liquor. The composition can significantly improve the activity of antioxidant enzymes such as SOD, CAT and the like, reduce the MDA content and improve the cognitive and athletic ability.

The application of Remdesivir in the treatment of BmCPV infected silkworm belongs to the field of molecular biology and virology, when Remdesivir is used with a final concentration of 0.125 mg / mL to treat 1*10^6 BmCPV virus infected silkworm, the expression of BmCPV virus S1 gene can be effectively inhibited, thereby the replication of BmCPV virus is inhibited, and treatment effect is achieved. The present application can provide a theoretical basis for the research and development of silkworm midgut type pyosis treatment drugs, and provide ideas and directions for the research of RNA virus treatment drugs.

The invention discloses an RPA primer group for detecting serratia marcescens of bombyx mori as well as a kit and application of the RPA primer group, and belongs to the technical field of rapid detection of microorganisms. The RPA primer group comprises a forward primer of which the nucleotide sequence is shown as SEQ ID NO: 3 and a reverse primer of which the nucleotide sequence is shown as SEQ ID NO: 4, and the forward primer and the reverse primer are cooperatively matched with crRNA of which the nucleotide sequence is shown as SEQ ID NO: 7, and a rapid detection system for serratia marcescens is established by combining an RPA isothermal amplification technology and a CRISPR / Cas12a (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR / CRISPR / CRISPR / CRISPR / CRISPR / CRISPR / CRISPR / Cas12a) detection system. After nucleic acid extraction is carried out on a sample to be detected, the RPA primer group is adopted for carrying out amplification reaction under the constant-temperature condition, an amplification product is mixed with crRNA, Cas12a protein and a single-stranded DNA report probe for detection, and a reaction result can be read through a fluorescence signal and can also be visually interpreted through the lateral chromatography test strip by naked eyes.

The application discloses a silkworm molecular breeding method with both anti-BmNPV and pyrethroid pesticide, which is efficient and practical. First, the silkworm variety of Su Hao and Zhong Ye is endowed with the performance of resisting pyrethroid pesticides through directional introduction and screening technology, and the related molecular markers are all dominant homozygous types. Secondly, the strategy of combining genetic breeding and molecular assisted breeding is adopted to introduce the anti-BmNPV characteristics of the silkworm AN variety, and the anti-pyrethroid pesticide molecular marker is stably controlled to be a dominant homozygous type. Finally, through strict screening and cultivation, a silkworm variety with significant economic advantages and double resistance to pyrethroid insecticides and BmNPV is obtained.

This invention provides a traditional Chinese medicine compound preparation for treating oviductitis in laying hens and its preparation method, belonging to the field of traditional Chinese veterinary medicine technology. Based on the principles of syndrome differentiation and treatment in traditional Chinese veterinary medicine, this invention rationally combines a traditional Chinese medicine compound preparation composed of Leonurus japonicus, Citrus aurantium, Euphorbia humifusa, Morus alba, Bombyx mori, Gynostemma pentaphyllum, Sophora flavescens, Solanum lyratum, Schisandra chinensis, and Glycyrrhiza uralensis. This compound preparation has the effects of clearing heat and dampness, promoting blood circulation and removing blood stasis, nourishing yin and replenishing qi, and strengthening the spleen and kidneys. This traditional Chinese medicine compound preparation can exert a significant anti-inflammatory effect by regulating the level of cellular inflammatory factors, and can enhance the body's immune function by regulating the level of immune proteins. Therefore, it can improve the egg production rate of laying hens affected by oviductitis, and reduce the mortality and defective egg rate caused by oviductitis. This traditional Chinese medicine compound preparation has great application prospects in the treatment of oviductitis in laying hens.

The invention relates to the technical field of crossbreeding, and discloses a crossbreeding method for natural colored cocoons of silkworms. The crossbreeding method of the natural colored silkworm cocoons comprises the following steps: hybridizing a carrier parent and a receptor parent, introducing a yellow cocoon gene, and then backcrossing and assembling to obtain the natural colored silkworm cocoons. The natural colored silkworm cocoon variety with excellent practical characters bred by the method is a natural colored silkworm cocoon variety with excellent golden yellow cocoon color character stability and practical character stability; according to the natural colored silkworm cocoon variety with excellent practical characters bred by the method, the cocoon yield of each silkworm cocoon is up to 40kg, the total cocoon yield is up to 1.7 g, the cocoon shell yield is up to 0.37 g, and the cocoon shell rate is up to 22%.