RPA kit for detecting cyprinid herpesvirus 2, CyHV-II in real time at constant temperature, and primer and probe special for RPA kit
A carp herpes virus, real-time detection technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve problems such as unfavorable sequencing construction, cumbersome primer design, and long time-consuming PCR technology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Design and screening of RPA-specific primers and probes for constant temperature real-time detection of type II carp herpes virus
[0026] The present embodiment entrusts Shanghai Bioengineering Company to design specific primer sequences and probe sequences for the CyHV-II target gene, wherein:
[0027] The forward primer sequence is CCCAGGAGACCAGCAGACTGTTGAACCCGTAC;
[0028] The reverse primer sequence was GTATCCGCCTCGTCCATCATAGAGCCGAAACC.
[0029] The probe sequence is:
[0030] cactctggcgacgcgtttgtggttgaaccgcca(BHQ1-dt)c(THF)g(FAM-dT)ggaggcttcaaaggc(C3spacer).
Embodiment 2
[0031] Example 2 Specificity evaluation of RPA detection
[0032] First follow the steps below to extract the CyHV-II virus, including:
[0033] (1) Add an appropriate amount of PBS buffer and mix well, centrifuge at 8000rpm for 5min, and discard the supernatant;
[0034] (2) Add 1ml of buffer and 20μL of protease and incubate in a water bath at 56°C for 3h;
[0035] (3) Centrifuge at 8000rpm for 5min, take 750μL of the supernatant and put it in a new centrifuge tube, add phenol: chloroform: isoamyl alcohol at a volume ratio of 25:24:1, mix at 50rpm for 10min, then centrifuge at 8000rpm for 5min, Take 650 μL of supernatant to a new centrifuge tube, repeat the above operation and ensure that the protein layer is not sucked;
[0036] (4) Take 600 μL of supernatant in a new centrifuge tube, add chloroform:isoamyl alcohol at a volume ratio of 24:1, mix at 50 rpm for 10 min, and then centrifuge at 8000 rpm for 5 min;
[0037] (5) Take 480 μL of supernatant in a new centrifuge tu...
Embodiment 3
[0042] Sensitivity evaluation of embodiment 3RPA detection
[0043] The extraction method of CyHV-II virus is the same as embodiment 2, then get the DNA of CyHV-II and carry out multiple dilution, each dilution is carried out RPA fluorescence quantitative PCR amplification, wherein, 1 and 2 are positive DNA samples, and 2 is the dilution 10 3 times for the positive DNA sample, 3 times for the negative control water. The experimental results are attached figure 2 As shown, the No. 1 positive sample can detect obvious bands in the 5th cycle (about 4min), and the significant experimental results can be observed in the 10th cycle (about 8min); the No. 2 sample can be detected in the 10th cycle (about 8min) obvious bands can be detected, and significant experimental results can be observed in the 15th cycle (about 16min); No. 3 negative sample has no non-specific amplification bands.
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap