Supercharge Your Innovation With Domain-Expert AI Agents!

PCR primer ad kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and application of PCR primer

A detection kit, a technology for herpes virus, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of infection, economic loss of crucian carp breeding industry, etc. Wide applicability and practicality, the effect of low false positive rate

Active Publication Date: 2017-04-19
THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology describes methods and tools used during researches into identifying cycling agents called cyclistella (CY) sinensis). These techniques involve amplification or testing DNA from these organisms' genome. They provide fast, easy access, precise results at lower costs than traditional laboratory tests while also being able to identify various bacterial species like Escherichia coli O157: H7. Additionally, they allow scientists to study how certain chemical substances affect their ability to fight off disease caused by harmful microorganism such as Bacillaria spp., Plasmodium falciparum malaria parasites, etc.. Overall, this technique allows us to make faster, easier ways to diagnose diseases related to cytomegalovirus type 1(cyclidylinenomenon), including Chikungunya fever, Yellow Fever, Dengue hemorrhagie syndrome, Crimea, Lyme disease, West Nile encephalitis, SARS coronaviruse, influenza pandemics, tuberculosis, dengue fevers, chickenpox, polio epidemies, hepatitis A, rheumatoid arthritis, lupencepsemia, leprotopenia, sarcoidosis, cancer, necrotropic enterobiliary pancreatitis, lipid storage disorders, Parkinson’sdisease, amyotrophic lateral sclerostomy defective patients, cardiac failure, stroke, brain damage, spinal cord injury, muscle degeneration, multiple myeloma, Alzheimer′s disease, autosensory nerve injuries, pulmonary embolysms, respirator attacks, gastroenteropathisis, diarrhoea, urinary tract symptoms, urogenital abnormalities, central nervous systems problems associated therewith, especially those involving neuronal cells involved in cognitive function.

Problems solved by technology

This patents describes various technical problem addressed in this patented text relating to the spread of Cytospora sialonchisis due to its ability to cause severe damage to cropped crayfishes during their growth cycle. Current diagnoses involve visual inspections with blood smears from affected individuals followed by microscopic analysis. However, these tests require expensive equipment and trained operators who may miss important parts like young broods. Therefore, an improved assays system capable of quickly identifying different strains of bacterium called CyHv-III would provide better tools for understanding how Cytosiherapy treatments targeted against Fish Hydronephritis affect wild populations around the globe.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer ad kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and application of PCR primer
  • PCR primer ad kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and application of PCR primer
  • PCR primer ad kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and application of PCR primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Detection CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ test of Cyprinidae herpesviruses

[0043] 1) Reagents

[0044] 10×Taq Buffer: Tris-HCl 100 mM, KCl 500 mM, MgCl 2 20 mM, dNTPs 2 mM, Taq enzyme 1U / μL;

[0045] Primers: CyHV-F, CyHV-R, 10 μM each, pure water, positive quality control DNA 10 μg / ml;

[0046] The primer sequences are:

[0047] Upstream primer: CyHV-F: CACCTCTTGTTTTCSGCCAAC SEQ ID NO:1

[0048] Downstream primer: CyHV-R: AGGTCMGGCCTGGGCAGACC SEQ ID NO:2

[0049] Positive quality control: including the nucleic acid DNA of CyHV-Ⅰ, CyHV-Ⅱ, CyHV-Ⅲ viruses of Cynidae herpesviruses. Among them, CyHV-Ⅰ, CyHV-Ⅱ and CyHV-Ⅲ are artificially synthesized (Bosun Biotechnology (Shanghai) Co., Ltd., the same below) containing the following sequences of the target fragments amplified by the above primers:

[0050] CyHV-1: CACCTGCTCTTCTCCGCCAACAGGTGGGAGCTGGTGCCCCTGATGAAGCAGAAGCTGGAACGGGGGACGAGCCTGGTGTTGGACAGGTACGCATTCTCCGGTGTGGCATTCAGCAGCGCGAAACCTGACATGCCCGTGGAGTGGTGCATG...

Embodiment 2

[0069] Example 2: Simultaneous detection of CyHV-I, CyHV-II, and CyHV-III PCR detection primers, kits and detection methods for further effect detection.

[0070] 1. Sensitivity experiment

[0071] Dilute the above-mentioned artificially synthesized positive quality control substance, and successively dilute to 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL, respectively used as PCR templates for sensitivity experiments. see results Figure 1-3 .

[0072] figure 1 It is the sensitivity experiment result graph of CyHV-Ⅰ virus detection in the PCR system, in which the lane M is TakaraDL2000 DNA Marker, and the lanes 1-10 are positive quality control products (from 1 to 10 are 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copy / μL)), lane 11 is the negative control. It can be seen from the figure that there are clear amplified bands of about 182 bp in lanes 1-10, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a PCR primer and a kit for simultaneously detecting cyprinid herpesvirus I, cyprinid herpesvirus II and cyprinid herpesvirus III and an application of the PCR primer. The primers include CyHV-F and CyHV-R, with sequences shown as SEQ ID NO: 1 and SEQ ID NO: 2. The primer provided by the invention, when used for detection, is free from a cross reaction with other viruses and the primer is low in false positive rate; and the three cyprinid herpesviruses, namely CyHV-I, CyHV-II and CyHV-III, can be rapidly, accurately and conveniently detected and distinguished simultaneously. The invention provides a molecular biological technical basis for the early diagnosis and the prevention and treatment of the cyprinid herpesviruses. The primer has broad applicability and practicability.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner THIRD INST OF OCEANOGRAPHY STATE OCEANIC ADMINISTATION
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More