42 results about "Applications of PCR" patented technology

The invention specifically relates to a PCR amplimer for environmental DNA detection of Chinese sturgeon, a detection method using the PCR amplimer and application of the PCR amplimer, belonging to the field of biotechnology. The sequences of ASCB1F and ASCB1R of the PCR amplimer are 5'-ACAATGCCACCCTTAC-3' and 5'-TGTCTGCGTCTGAGTTT-3', respectively. The site of a DNA molecular marker of a Chinese sturgeon species is located in the mitochondrial CYTB gene of the Chinese sturgeon; a DNA fragment has a length of 138 bp and a sequence as shown in SEQ ID No. 1; the PCR amplimer is used for environmental DNA amplification, an amplification product is compared with the sequence of the site of the DNA molecular marker, and if the non-primer zones of the amplification product and the site sequence are 100% matched, a detected species is the Chinese sturgeon species. According to the invention, identification of the Chinese sturgeon species is realized by using environmental DNA detection, and a sample from a fish body is not needed, so damage to the fish body is avoided.

The invention discloses a polymerase chain reaction (PCR) primer pair for identifying or assisting in identifying duck tissues and / or organs and application of the PCR primer pair. The PCR primer pair for identifying or assisting in identifying the duck tissues and / or organs consists of two single-stranded deoxyribonucleic acids (DNAs), namely 1) a single-stranded DNA shown as a sequence 1 in a sequence table and a single-stranded DNA shown as a sequence 2 in the sequence table, and 2) a single-stranded DNA shown as a reverse complementary sequence of the sequence 1 in the sequence table and a single-stranded DNA shown as a reverse complementary sequence of the sequence 2 in the sequence table. The detection method is high in specificity, and the duck tissues and / or organs doped into cattle, sheep, pigs and chicken can be identified; the whole result is clear and has high credibility; and the method is short in detection time, and only 8 hours is needed from the extracting of genomes to the finishing of enzyme cutting.

The invention discloses a polymerase chain reaction (PCR) amplification buffer solution for high-GC-content genes. The PCR amplification buffer solution for the high-GC-content genes is prepared from the following components: 150m mol / L of Tris-HCl, 40 m mol / L of (NH4)2SO4, 2.6 mol / L of betaine monohydrate, 0.02% of emulsifying agent Tween 20 and 20% of PCR reaction enhancer; after the components are collocated, a product is filtered to remove bacteria and then is stored at the temperature of 20 DEG C below zero. The invention also discloses an amplification method and application based on the PCR amplification buffer solution for the high-GC-content genes. The PCR amplification buffer solution uses the (NH4)2SO4 to replace KCL, thus improving the specificity of combination of a primer and a template and being capable of being compatible with a broader spectrum of Mg<2+> range.

The invention discloses a PCR primer for detecting duck adenovirus type 4 as well as a detection method and application thereof. The primer capable of rapidly detecting the duck adenovirus type 4 andthe PCR detection method of the primer are established for the first time, operation is easy, cost is low, and consumed time is short. Moreover, the PCR detection method for detecting the duck adenovirus type 4 is high in accuracy, good in specificity and high in sensitivity, the lowest detection limit is 6*10 <1> copies, clinical popularization and application are facilitated, and technical support is provided for carrying out adenovirus type 4 molecular epidemic virology investigation and related detection work in duck flocks.

The invention discloses a PCR detection primer and method of Vibro Splendidus and application of the PCR detection primer. The PCR detection primer is characterized by being designed according to the DNA sequences of a fur gene of Vibro Splendidus, the sequences of the designed PCR detection primer are VSFur RTF3:5'-ACAACAACCAGATTGCCAACA-3' and VSFurRTR3:5'-GATAACTTCACCGCAGTCTAAACAT-3'. The PCR detection method includes the following steps of firstly, preparing a matrix of seawater, apostichopus japonicus epidermis, apostichopus japonicus muscle or apostichopus japonicus coelomic fluid; secondly, establishing a 25-microlitre PCR reaction system; thirdly, conducting a PCR reaction, and finally conducting agarose gel electrophoresis to conduct result analysis. The PCR detection primer can be used for detecting Vibro Splendidus in seawater, apostichopus japonicus epidermis, apostichopus japonicus muscle or apostichopus japonicus coelomic fluid and has the advantages of being high in detection speed and sensitivity.

The invention relates to a pair of PCR (polymerase chain reaction) detection primers for Arceuthobium sichuanense based on an ITS2 segment, belonging to the field of molecular biology. The primers comprise the following gene sequences: dwF3:5'-ACAAACTCATTTTCCCA CCACA-3'; dwR3: 5'-ACATTCAAGAAACCTGAC ACCC-3'. The primers provided by the invention have the advantages of short detection period, reliable result, high sensitivity and the like, and is simple to operate, can effectively monitor and early warm infection dynamic of Arceuthobium sichuanense, guide the formulation of scientific disease management policy and have important meaning for preventing and controlling the disease of the Arceuthobium sichuanense by adopting effective measures.

The invention discloses a PCR-SSCP primer pair for detecting mutation of a DGAT1 gene. The nucleotide sequence of a forward primer of the PCR-SSCP primer pair is shown as SEQ ID NO.1 in a sequence list, and the nucleotide sequence of a reverse primer is shown as SEQ ID NO.2 in the sequence list; and the invention also provides the application of the primer pair in yak milk quality predication and identification as well as identification method and a corresponding kit. The primer pair provided by the invention has the beneficial effects that the pair of primers are designed in accordance with the sequence of an area from the 15th intron to the 17th exon of the DGAT1 gene of bos turus; genome DNA of a yak is subjected to PCR amplification and SSCP typing screening detection is implemented; the genotype and the allele of the yak DGAT1 gene are determined by analyzing a banding pattern; SNPs mutation is determined by conducting allele sequence alignment; and the influence of the mutation of the DGAT1 gene to a butter-fat percentage is analyzed, so that the butter-fat percentage of the yak is predicted; and the primer pair has the advantages of being sensitive in response, strong in specificity, simple to operate and high in accuracy, and rapid detection can be implemented.

The invention belongs to the technical field of plant virus detection, and in particular relates to PCR primers for detecting a cactus X virus and applications of the PCR primers. The primers comprise an upstream primer CVX-CPF: 5'-CAGTCCGCCGGACCCCG-3', and a downstream primer CVX-CPR: 5'-AGACTCTGAACCTTGGAGCCCC-3'. The PCR primers provided by the invention have certain universality for detecting CVX, can be used for detecting the CVX virus on dragon fruits, and also can be used for detecting the CVX virus in cactus. According to a detection method for detecting the CVX virus on dragon fruits, the inverse transcription and PCR amplification are carried out in one step, thus the probability of cross contamination can be greatly reduced, and meanwhile, the detection efficiency is greatly improved. The practical applications show that the operation is simple and convenient, the detection sensitivity is relatively high, and about 1 pg can be detected.

The invention discloses PCR detection primers for klebsiella as a pathogeny of a mulberry bacterial wilt disease and an application of the PCR detection primers. According to the PCR detection primerdisclosed by the invention, a group of klebsiella PCR detection primers is designed according to the klebsiella as the pathogeny of the mulberry bacterial wilt disease, the nucleotide sequence is as shown in SEQID NO:1-2, and the PCR detection primers can be used for detecting diseased plants and rhizosphere soil samples infected with the klebsiella as a pathogenic bacterium of the mulberry bacterial wilt disease, and have good detection effects. The PCR detection primers have important significance in fast detection of the klebsiella as the pathogenic bacterium of the mulberry bacterial wiltdisease in diseases of mulberries in a mulberry orchard, have good application value and are worth promotion.

The invention discloses a PCR detection method for human hsa-miR-124a-3p. The PCR detection method comprises the following steps: 1) extracting total RNA; 2) performing RT-qPCR detection: an RT primer is 5'-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGCATTC-3', an RTreaction procedure refers to 16DEG C for 30min, 42DEG C for 30min and 85DEG C for 5min; qPCR procedure refers to 50DEG Cfor 2min, 95DEG C for 10min, 95DEG Cfor 15s, 60DEG C for 60s, and 35cycles; 3)calculating concentration of to-be-detected hsa-miR-124a-3p. The invention further discloses an application of the PCR detection method to DS (Down's syndrome) pregnancy rick prediction.10<-5>-10<-3> pmol / mu L is determined as a DS high risk interval value of the detection method.

The present invention discloses two pairs of PCR-SSCP primer pairs for detecting UCP1 gene mutation, wherein the two PCR-SSCP primer pairs respectively are P5 and P6, and the nucleotide sequences of the forward primers and the reverse primers are represented by SEQ ID NO.1-4 in the sequence table. The invention further provides applications of the two PCR-SSCP primer pairs in yak meat quality trait prediction and identification methods, an identification method, and a corresponding kit. According to the present invention, the primers P5 and P6 are designed according to the UCP1 gene sequence of common cattle, the UCP1 gene of yak is amplified, the sequence and the population genetic characteristics of the UCP1 gene detection region are analyzed, the Gannan yak meat production performance determination data is combined, the influence of the UCP1 gene mutation on the carcass and the meat quality traits is analyzed, and the important economic trait candidate gene molecule genetic study data of yak is enriched, such that the meat quality traits of yak are predicted, and the advantages of sensitive reaction, strong specificity, easy operation, high precision and rapid detection are provided.

The invention discloses a PCR detection primer and a kit for Cedecea neteri and an application of the PCR detection primer and the kit. The sequence of an upstream primer of the PCR detection primer is 5'- GAGACGACCTGCGACAGGATT -3'; and and the sequence of a downstream primer is 5'- CAGCACTCGAGGCATAACCAG -3'. The PCR detection primer disclosed by the invention is high in specificity, can be used for identifying whether the pleurotus geesteranus sporocarp contains the Cedecea neteri or not, can be used for detecting the Cedecea neteri in a mushroom stick and a cultivation environment, and can be used for preventing diseases from outbreak and prevalence; and effective technical guidance is provided for early diagnosis, detection and prevention of pleurotus geesteranus yellow spot and other edible mushroom diseases.

The invention belongs to the technical field of PCR, and particularly relates to a PCR detection kit for rapidly identifying mycoplasma hyopeumoniae, mycoplasma synoviae and mycoplasma hyorhinis, and applications of the PCR detection kit. The PCR detection kit comprises PCR premix buffering solution, superpure water, Marker DL2000, upstream primer, downstream primer, a negative control and a positive control. The sequence of the upstream primer is 5'-ACACCATGGGAGCTGGTAAT-3'; the sequence of the downstream primer is 5'-GTTCATCGACTTTCAGACCCAAGGCAT-3'. The PCR kit has the advantages of being low in detection limit, good in sensitivity, strong in specificity and the like, can rapidly detect and identify mycoplasma hyopeumoniae, mycoplasma synoviae and mycoplasma hyorhinis.

The invention relates to the field of SARS-CoV-2 nucleic acid detection, in particular to a PCR (Polymerase Chain Reaction) target sequence, primers and a probe for detecting infectious SARS-CoV-2 and application of the PCR target sequence, the primers and the probe. The PCR target sequence, the primers and the probe for detecting the infectious SARS-CoV-2, which are provided by the invention, can be used for well distinguishing the infectivity of the SARS-CoV-2, and meanwhile, the PCR target sequence, the primers and the probe have the characteristics of high sensitivity and good repeatability. Compared with a conventional infectious SARS-CoV-2 detection test, the the PCR target sequence, the primers and the probe have the advantages that the test period of infectious SARS-CoV-2 detection is greatly shortened, the requirements on scientific research conditions and equipment are reduced, nucleic acid of virus inactivation caused by virus capsid protein damage and infectious virions are effectively distinguished, the detection accuracy is improved, and the false positive phenomenon occurring in actual detection is reduced.

The invention relates to a gene probe for alveolar soft part sarcoma and application of a gene probe kit. Clonal fragments selected and used by the gene probe are RP11-634L10, RP11-51H16 and RP11-475F12 combination as well as CTD-2311N12, RP11-416B14, CTD-2522M13, CTD-2312C1 and CTD-2248C21 combination respectively. According to the gene probe, the defects of an influence on prognostic and postoperative treatment and the like due to a tedious and time-consuming RT-PCR (reverse transcription-polymerase chain reaction) and cell karyotype analysis method, limitation of RT-PCR application by RNA degradation and numerous other factors, and inaccurate diagnosis are overcome; the gene probe is high in accuracy, specificity and success rate, strong in fluorescent signal and easy and convenient to operate, and can be applied to paraffin sections; the specimen detection range is extended, a novel method for accurately, reliably, simply and conveniently diagnosing the alveolar soft part sarcoma is built, and a precedent for detecting the alveolar soft part sarcoma by FISH (fluorescence in situ hybridization) is created.

The invention provides a PCR reagent for detecting tumor medicine targets, and an application of the PCR reagent. The PCR reagent comprises a PCR reaction primer for detecting relevant genes of ABCC1,AKT1, AKT2, ATF2, AURKA, AURKB and the like and internal reference genes and the like. Target tumor medicines are concentrated on a flat, and through primary real-time fluorescent quantitation PCR reaction, liver cancer Huh7 treated with medicines and untreated liver cancer Huh7 are used for contrast by core adjust and control molecules of reaction cells on medicine reaction, a possible way of the core signal molecules treated with the medicines is discussed, and a most direct evidence is provided for adjust and control of research on key proteins. The core signal molecules of the tumor medicine target can be quickly and accurately found from a transcriptional level, and a powerful tool is provided for discussion of a new targeted medicine mechanism, development of a targeted tumor inhibitor, and the like.

The invention discloses a PCR primer set for detection of Pepper vein mottle viruses (PVMV). The PCR primer set includes three nuclear inclusion protein b gene (NIb) specific primers of the Pepper vein mottle viruses and two reference gene Actin specific primers of solanaceous plants, wherein the three nuclear inclusion protein b gene (NIb) specific primers of the Pepper vein mottle viruses are PVMV-F1, PVMV-F310 and PVMV-R824, and the two reference gene Actin specific primers of solanaceous plants are PeActin-F1 and PeActin-R1093. Detection of PCR amplification results is performed in 1.0%-1.5% of agarose, no expensive fluorescent quantitative PCR instruments are needed, and the primer set has the characteristics of a high speed, economy, high stability, high accuracy and high sensitivity.

The invention discloses a PCR (polymerase chain reaction) primer pair and method to detect Schlumbergera virus X and application of the PCR primer pair. The primer pair includes an upstream primer SchVX CP-F: 5'-GGTCATCACCGGAAACTGT-3', and a downstream primer SchVX CP-R: 5'-CTTTGGGCTTTCAGATCCTT-3'. The PCR primer pair can be applied to the detection on whether Hylocereus undulatus, Opuntia strictaand Schlumbergera truncata experience Schlumbergera virus X infection.

The invention provides a PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of the PCR kit. The composition disclosed by the invention comprises the following sequences: (1) an upstream primer Primer-Myc-F: TGAGTAGTATGCTCGCAAGAGTG, (2) an upstream primer, (3) a downstream primer, (4) an upstream primer and (5) a downstream primer, wherein the upstream primer is used for PCR (Polymerase Chain Reaction) amplification of a mycoplasma nucleic acid sequence; and (2) a downstream primer Primer-Myc-R: CGACACGAGCTGACGACAAC, which is used for carrying out PCR (Polymerase Chain Reaction) amplification on the nucleic acid sequence of the mycoplasma. The composition can be used for preparing a PCR kit. The composition or the kit can be used for mycoplasma detection. Compared with the existing PCR (Polymerase Chain Reaction) primer amplification method, the primer pair disclosed by the invention is optimized, so that Primer-BLAST shows that 528 products can be amplified, and the primer pair has high spectral property.

The invention discloses a PCR-HRM (Polymerase Chain Reaction-High Resolution Melting) primer for authenticating a swine acute diarrhoea syndrome virus and a porcine epidemic diarrhea virus, a method for authenticating a swine acute diarrhoea syndrome and porcine epidemic diarrhea, and application of the PCR-HRM primer. A primer pair provided by the invention has good specificity, only one pair ofprimers needs to be used for carrying out PCR amplification on the SADS-CoV (Swine Acute Diarrhoea Syndrome Coronavirus) and the PEDV (Porcine Epidemic Diarrhea Virus), a bonding situation of a double-stranded DNA fluorescent dye and a PCR amplification product in a temperature rise process can be monitored in real time, and fluorescent data is collected and is authenticated according to the difference of two virus melting curves. The detection method provided by the invention does not need the separation and identification of viruses, virus authentication time is shortened, gel electrophoresis is not required for observing a result, and software can be used for analyzing the result when the PCR is finished, cost is low, a specific probe is not required, and the fluorescent saturable dye is cheap and can be easily obtained. The PCR-HRM primer has the characteristics of good specificity, high sensitivity and good repeatability, can accurately and quickly distinguish viruses, and can beprompted and used in clinical detection.

The invention discloses a PCR primer and a kit for rapidly identifying asarum plants, and applications of the PCR primer. The nucleotide sequence of the primer is as follows: Asa_F: 5'-TATCTCTTTCTTTTTTTCAAAAGG-3', and Asa_R: 5'-ATGGGCTTTTGCCAATGAGCCAATC-3'. The invention further discloses a method and a kit for rapidly identifying the asarum plants. The method and the kit are strong in specificity, high in sensitivity and high in accuracy.

The invention discloses a PCR-HRM primer and detection method for rapid identification of PRRSV gene subtype and application of the PCR-HRM primer. The sequence of the primer is as shown in SEQ ID NO.1-2, the PCR-HRM primer has good amplification for PRRSV vaccine strains widely used in the market and epidemic strains in pig farms, the PCR amplification efficiency is high, the detection sensitivity is high, the specificity is good, and the repeatability is high. According to the provided PCR-HRM detection method, operation foranalyzing and identifying four PRRSV gene subtypes is easy, the whole process only needs 2 hours, and the time required by genotyping is greatly shortened; the cost is low, sequencing is not needed, a synthetic probe is also not needed, and cheap and easily availablefluorescence saturated dye only needs to be added. The PCR-HRM primer can be used for preparing a PRRSV subtype detection kit, PRRSV subtype identification in farms, molecular epidemiological investigation and PRRSV subtype risk assessment in aquaculture, and the application prospect is broad.

The invention relates to the technical field of pseudomonas fluorescens detection, and provides a PCR primer for detecting pseudomonas fluorescens in raw milk and application of the PCR primer, so as to solve the problems that the existing PCR primer of pseudomonas fluorescens capable of producing heat-resistant protease is poor in specificity, high in detection limit and missed in detection, wherein an upstream primer F3: 5'-WSNGGNGGNGAYTTYCAYATGAC-3'; a downstream primer R3: 5'-RTCRTTNCCNCCNCCRTCCC-3'. The PCR primer pair has the advantages of being high in specificity, reliable in result and easy and convenient to judge and is suitable for food sample detection, and the detection method is high in speed, accurate and reliable in result, easy and convenient to operate and low in detection cost.

The invention provides a specific primer group for fox retrovirus detection and application of a PCR detection kit. The specific primer group for fox retrovirus detection comprises two pairs of primers, wherein the first pair of primers is as follows: an upstream primer 1 is as shown in SEQ ID No.1-F, and a downstream primer 1 is as shown in SEQ ID No.1-R; the second pair of primers is as follows: an upstream primer 2 as shown in SEQ ID No.2-F, and a downstream primer 2 is as shown in SEQ ID No. 2-R. The application of the specific primer group in PCR detection is particularly the application of the specific primer group in the PCR detection kit. By using the specific primer group for fox retrovirus detection, the sensitivity and the specificity of PCR can be improved, the accuracy of fox retrovirus detection is further improved, a fox retrovirus can be rapidly and accurately detected by applying the specific primer group to the PCR detection kit, and the sample treatment process and the detection process are simple.

The invention provides a primer group and a detection method thereof for detecting pancreatic cancer. The primer group includes primers shown as SEQ ID No.1 SEQ ID No.18, and the primer group is capable of conducting joint detection on CK18, CK20, CEA, Vimentin, MUC1, Epcam, Birc5, EGFR and C met genes. With the application of PCR (polymerase chain reaction) or fluorescent quantitative PCR, the expression and expression levels of target genes can be sensitively detected within a short time; through optimized PCR conditions, an observation result becomes more obvious, so that the applicability of the primer group and the detection method provided by the invention is further improved; and an amplification product is specific, so that the high accuracy and sensitivity of the PCR and fluorescent quantitative PCR detection are guaranteed. The primer group for detecting the pancreatic cancer, by detecting the expression of the target genes in a patient specimen, can be used for simply, conveniently and accurately diagnosing the pancreatic cancer.

The invention relates to a gene probe of acinar soft tissue sarcoma and the application of the kit. The cloned fragments selected by the gene probe of the present invention are the combination of RP11-634L10, RP11-51H16 and RP11-475F12, and the combination of CTD-2311N12, RP11-416B14, CTD-2522M13, CTD-2312C1 and CTD-2248C21. The present invention overcomes the cumbersome and time-consuming RT-PCR and karyotype analysis methods, RNA degradation and many other factors that limit the application of RT-PCR, cannot obtain accurate diagnosis, and affect prognosis and postoperative treatment. The invention has high accuracy, high specificity, high success rate, strong fluorescent signal, simple operation, can be applied to paraffin sections, expands the scope of detection specimens, and establishes a new method for accurate, reliable and simple diagnosis of acinar soft tissue sarcoma. Created a precedent for the use of FISH to detect acinar soft tissue sarcoma.

The invention provides a PCR (polymerase chain reaction) detection kit for a CTG (cytotoxic T-G) region of an atrophic myotonic protein kinase gene. The PCR detection kit comprises specific primer pairs with nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively. The method has the characteristics of strong amplification specificity and small amplification preference. And meanwhile, the technical difficulty that the false negative is displayed when part of samples are detected by the existing method is overcome, and the detection of more than 1000 times of repeated variation is realized. The invention also provides an application of the PCR detection kit for the CTG region of the atrophic myotonic protein kinase gene. The PCR detection kit provided by the invention can be used for amplifying a hybrid allele sample carrying CTG repeated expansion, and can be used for detecting the number of CTG tribasic group repetition times of an atrophic myotonic protein kinase gene 3 '-UTR at the same time.

The invention relates to a PCR amplification primer and a probe for detecting AMY2B gene copy number and an application of the PCR amplification primer and the probe. The PCR amplification primer comprises an upstream primer and a downstream primer, wherein the sequences of the upstream primer and the downstream primer are as follows respectively: the upstream primer is 5'-GAACCATGATCACCCACCTGCATTCT-3', and the downstream primer is 5'-TGTGCTACACCTCCCAACCTTAATCAATCA-3' the sequence of the probe is 5'-CTGGGTGACAGAGTGAGACCCTCCTCCCTCC-3'. The PCR amplification primer designed by the invention hashigh specificity, can specifically amplify the AMY2B gene, and does not amplify other genes in a whole blood DNA sample, and the PCR amplification primer is combined with a probe, so that the copy number of the AMY2B gene can be rapidly detected.

The invention discloses a preparation method of a PCR positive control substance; the pollution of the positive control substance to a nucleic acid amplification system can be obviously distinguished,the accuracy of PCR detection is improved and the false positive is reduced. The nucleic acid sequence of a PCR positive fragment has a section of sequence removed from two primers, and then clone engineering bacteria are transformed. A positive plasmid is extracted as a control. The transformed control does not affect the combination of PCR primers, also does not affect the amplification efficiency of PCR products. Moreover, because the length of the fragment is smaller than that of normal positive sample products, the fragment can be distinguished significantly when agarose electrophoresisis carried out, and thus a role in distinguishing pollution is played.