Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group and detection method for detecting pancreatic cancer

A primer set and pancreatic cancer technology, applied in the field of tumor genes, can solve the problems that the detection standards of pancreatic cancer CTCs have not been established, and achieve the effects of fast detection speed, simple operation, and low cost

Inactive Publication Date: 2017-03-22
ZHEJIANG UNIV +2
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, the detection standard of pancreatic cancer CTCs by RT-PCR method has not been established yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and detection method for detecting pancreatic cancer
  • Primer group and detection method for detecting pancreatic cancer
  • Primer group and detection method for detecting pancreatic cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Gene selection

[0034] Many studies have shown that the sensitivity of single-gene screening is about 20-60%. Most of the single-gene tests used for early tumor screening have low detection sensitivity or specificity, which cannot meet clinical needs. Multi-gene combined detection can effectively solve the problem of low sensitivity and improve the accuracy of early tumor screening and diagnosis. Zhou J et al. (Zhou J, Hu L, YuZ, et al. Marker expression inducing cancer cells of pancreatic cancer patients. J Surg Res 2011; 171:631–6.) simultaneously detected hTERT, CK20, C-met, and CEA genes, and the results It shows that the sensitivity of combined detection of four genes for early diagnosis of pancreatic cancer is much higher than that of single gene detection. In order to increase the detection rate of early tumors, improve the cure rate of tumor patients, and improve the prognosis of patients, we screened the differentially expressed genes between pancr...

Embodiment 2

[0035] Embodiment 2: primer screening

[0036](1) Design primers a1~a3, b1~b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3, specifically: use bioinformatics software to The A-I sequence of the target gene was analyzed, and a specific primer set was designed by using the sequence analysis software, and the specificity of each paired primer in the human genome was detected by the NCBI primer search software, and three pairs of specific amplification primers a1~a3, b1~ b3, c1~c3, d1~d3, e1~e3, f1~f3, g1~g3, h1~h3, i1~i3;

[0037] Table 1: PCR Detection Primers

[0038]

[0039]

[0040]

[0041]

[0042] (2) Processing of peripheral blood samples

[0043] The peripheral blood of pancreatic cancer patients admitted to a hospital and confirmed by pathology was collected. Fresh blood was collected through the cubital vein at 7:00 am on an empty stomach, stored in an anticoagulant tube, shaken well, and stored at room temperature for ≤4hr.

[0044] 2.1 Add an equal...

Embodiment 3

[0075] Example 3: Effect Verification

[0076] According to the screening results in Example 2, 200 tumor samples were tested using the primer sets described in the table below.

[0077]

[0078]

[0079] Among them, the forward primer of CK8 is CGCCTGGAAGGGCTGACCGA, the reverse primer is GTTGGCAATATCCTCGTACT; the forward primer of N-cadherin is CCTTAACTGAGGAGTCAGTG, and the reverse primer is CAGACCTGATCCTGACAAGC; the forward primer of VEGF is GTGCCCGCTGCTGTCTAATG, and the reverse primer is CACATCTGCAAGTACGTTCG; The primer was GAGAAGCAGAGCCATGTGGT and the reverse primer was GCACTCTTCCTCCAACTGCC.

[0080] The detection rates of primer sets 1 to 9 are shown in the above table. It can be seen from the table that, in the primer set, as the number of primers increases, the detection rate can be improved to a certain extent. Further, by comparing the primer sets No. 5 to No. 9, it can be found that the combination in the primer set has an important influence on the detection ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group and a detection method thereof for detecting pancreatic cancer. The primer group includes primers shown as SEQ ID No.1 SEQ ID No.18, and the primer group is capable of conducting joint detection on CK18, CK20, CEA, Vimentin, MUC1, Epcam, Birc5, EGFR and C met genes. With the application of PCR (polymerase chain reaction) or fluorescent quantitative PCR, the expression and expression levels of target genes can be sensitively detected within a short time; through optimized PCR conditions, an observation result becomes more obvious, so that the applicability of the primer group and the detection method provided by the invention is further improved; and an amplification product is specific, so that the high accuracy and sensitivity of the PCR and fluorescent quantitative PCR detection are guaranteed. The primer group for detecting the pancreatic cancer, by detecting the expression of the target genes in a patient specimen, can be used for simply, conveniently and accurately diagnosing the pancreatic cancer.

Description

technical field [0001] The invention relates to the field of tumor genes, in particular to a primer set and a detection method for detecting pancreatic cancer. Background technique [0002] Pancreatic cancer is a highly malignant tumor of the digestive system, the fourth leading cause of cancer death in the United States and one of the deadliest malignancies worldwide. The death rate of pancreatic cancer ranks 7th to 8th in my country. [0003] In the past 30 years, the annual survival rate of pancreatic cancer has only increased from 2% to 6%, while in the same period, the 5-year survival rate of all tumors has increased from 49% to 68%, and the survival rate of some cancers can even reach 90%. above. The anatomical part of the pancreas is hidden, and it is difficult to detect and diagnose pancreatic cancer at an early stage. When the patient has clinical symptoms, metastasis has already occurred, and it is difficult to be surgically removed. Due to its high invasiveness...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/156
Inventor 徐以兵黄东胜隋梅花牟一平洪德飞胡薇蕾朱珍芳
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com