PCR detection primer and kit for Cedecea neteri and application of PCR detection primer and kit

A technology for detection of primers and Western bacterium, applied in the field of microbiology, can solve the problems of inability to accurately determine whether edible fungus cultures contain pathogenic bacteria, early diagnosis and prevention of diseases, etc., to achieve macular disease avoidance, high sensitivity, and prevention The effect of disease

Active Publication Date: 2022-01-04
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The invention overcomes the technical problems in the prior art that it is impossible to accurately determine whether the edible fungus culture contains pathogenic bacteria, and it is impossible to diagnose and prevent the occurrence of diseases in advance, and provides a PCR detection primer, kit and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection primer and kit for Cedecea neteri and application of PCR detection primer and kit
  • PCR detection primer and kit for Cedecea neteri and application of PCR detection primer and kit
  • PCR detection primer and kit for Cedecea neteri and application of PCR detection primer and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] A kind of PCR detection primer pair of Sidsiella Neeschii, the upstream primer sequence of the PCR detection primer pair is: 5'-GAGACGACCTGCGACAGGATT-3'; the downstream primer sequence of the PCR detection primer pair is: 5'-CAGCACTCGAGGCATAACCAG -3'.

Embodiment 2

[0027] The present example studies the application of the PCR detection primer pair in Example 1 in the identification of Sidsiella Neschii.

[0028] Utilize the PCR detection primer of embodiment 1 to detect the method for edible fungus pathogenic bacteria, described method is:

[0029] (1) Collection of samples: collect cultures of Pleurotus officinalis sticks (including hyphae and fruiting bodies) infected with yellow spot disease and the soil where the sticks are placed from the planting bases of Pleurotus osmanthus where yellow spot disease often occurs.

[0030] (2) Extract the genomic DNA of the bacterial stick culture to be tested: Rinse the fruiting body tissue of the freshly collected pathogenic Pleurotus chinensis with sterile water, dry it naturally, soak it in 75% alcohol for about 10s, and then use sterile Rinse with bacterial water for 3-4 times, and use the fungal genomic DNA extraction kit to extract DNA. For specific steps, refer to the kit manual. The method...

Embodiment 3

[0036] What this embodiment researches is the influence of the detection period on the preventive effect during the cultivation process of Pleurotus osmanthus. This embodiment adopts the method of sampling detection. In the same fruiting shed, the shed is divided into three areas to cultivate pear mushrooms respectively. The distance between two adjacent areas in the three areas is 3 meters. Take 20 samples for testing when you open the bag mouth after spraying cold water, take 20 samples for testing on the first day after opening the bag mouth in area 2, and take 20 samples for testing on the second day after opening the bag mouth in area 3. During the detection, the PCR detection primers of Example 1 were used to detect the detection bacterial stick culture. The detection method is:

[0037] (1) Collect samples: collect mycelium and fungus stick compost at the sampling point.

[0038] (2) Genomic DNA extraction: the hyphae in the fungal sticks were directly extracted using...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a PCR detection primer and a kit for Cedecea neteri and an application of the PCR detection primer and the kit. The sequence of an upstream primer of the PCR detection primer is 5'- GAGACGACCTGCGACAGGATT -3'; and and the sequence of a downstream primer is 5'- CAGCACTCGAGGCATAACCAG -3'. The PCR detection primer disclosed by the invention is high in specificity, can be used for identifying whether the pleurotus geesteranus sporocarp contains the Cedecea neteri or not, can be used for detecting the Cedecea neteri in a mushroom stick and a cultivation environment, and can be used for preventing diseases from outbreak and prevalence; and effective technical guidance is provided for early diagnosis, detection and prevention of pleurotus geesteranus yellow spot and other edible mushroom diseases.

Description

technical field [0001] The invention relates to the technical field of microbes, in particular to a PCR detection primer, a kit and an application of Sidsiella naesuii. Background technique [0002] Sidsiella naesui is a new pathogen of edible fungi reported in recent years, which can cause Pleurotus chinensis yellow spot, Agaricus bisporus brown spot, Flammulina velutipes yellow sticky disease and Pleurotus chinensis soft rot. Aggravating, once it occurs, it will quickly break out and cause great economic losses. In order to prevent the occurrence, spread, and outbreak of edible fungus diseases caused by this pathogen, especially Pleurotus erodes macula, it is urgent to establish a method for rapid and accurate detection of pathogens. However, no molecular detection method for this pathogen has been established yet, and the detection technology is relatively weak, which seriously affects the quarantine and prevention of this disease. [0003] PCR detection of pathogenic b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12N15/11C12R1/01
CPCC12Q1/689C12Q1/686C12Q2565/125
Inventor 刘增亮陈雪凤吴圣进张雯龙
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap