Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer group for fox retrovirus detection and application of PCR detection kit

A technology of retrovirus and detection kit, applied in the direction of microbe-based methods, microbes, recombinant DNA technology, etc., can solve the problems of obvious litter characteristics, small fox fur, and difficult disease prevention and control, and achieve sample processing and The detection process is simple, the sensitivity and specificity are improved, and the effect of low level requirement

Active Publication Date: 2021-09-28
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, fox retroviruses have caused fox dysplasia, kidney enlargement, and growth retardation in fox breeding. The disease is not obviously contagious, but the litter characteristics are obvious. Finally, it has a serious impact on the growth of foxes. The most intuitive impact is that the fox fur is small, the fur is rough and scarce, and the fox dies, resulting in a reduction or extinction of fox fur production.
[0003] At present, there are no specific treatment and preventive measures for the above-mentioned diseases of foxes, making it difficult to prevent and control the disease. Under the current situation, in order to reduce breeding losses, timely detection of diseased foxes and timely stop loss are the most effective ways to reduce losses Therefore, how to accurately detect whether the fox is sick is of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer group for fox retrovirus detection and application of PCR detection kit
  • Specific primer group for fox retrovirus detection and application of PCR detection kit
  • Specific primer group for fox retrovirus detection and application of PCR detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 is used for the establishment of the PCR method that fox retrovirus is detected

[0036] This method screens and analyzes fox retrovirus gene sequences, and selects gag gene (NC_007815.2) as the target gene, which is derived from xenotropic murine leukemia virus-related virus (XMRV). The gene sequence is shown as SEQ ID No.3, as follows:

[0037] ATGGGACAGACCGTAACCACTCCCTTGAGTCTGACCCTTGAACACTGGGGAGACGTCCAGCGCATTGCGTCCAACCAGTCCGTGGACGTCAAGAAGAGACGCTGGGTCACCTTCTGCTCTGCCGAGTGGCCAACTTTCGATGTGGGGTGGCCGCAAGATGGTACTTTTAATTTGGACATTATTTTACAGGTTAAATCTAAGGTGTTCTCTCCCGGTCCCCACGGACACCCGGATCAGGTCCCATACATTGTCACCTGGGAGGCTATTGCCTATGAACCCCCTCCGTGGGTCAAGCCTTTTGTCTCTCCCAAACTCCCCCTCTCTCCAACCGCTCCCATCCTCCCATCCGGTCCTTTGACCCAACCTCCGCCCCGATCTGCCCTTTACCCTGCTCTTACCCCCTCTATGAAACCCAGACCTTCTAAACCTCAGGTTCTCTCCGATAACGACGGACCTCTCATTGACCTTCTCACAGAAGACCCTCCGCCGTACGGAGAACAGGGACCGTCCTCCTCTGACGGGGATGGCGACAGAGAAGAGGCCACCTCCACTTCTGAGATTCCTGCCCCCTCTCCCATGGTGTCTCGCCTGCGGGGCAAAAGAGACCCCCCCGCGGCAGATTC...

Embodiment 2

[0054] Embodiment 2 is used for to fox retrovirus PCR detection kit

[0055] The PCR detection kit includes nucleic acid release reagent, negative control, positive control, enzyme mix and primers.

[0056] Wherein, primer is the specific primer that embodiment 1 provides; Nucleic acid releasing agent is that described nucleic acid releasing agent is 200mM Tris-HCl (pH 8.0), 500mM NaCl, 5mM EDTA, 1% sodium dodecylsulfonate (SDS, W / V), 2% lithium dodecyl sulfate (LLS, W / V) and 1% betaine (W / V); the enzyme mixture is 0.1U / μL Taq DNA Polymerase (DNA polymerase), 2 ×PCR reaction buffer, 3mM MgCl 2 , 0.4mM dNTPs; the positive control is the pMD18T-GAG plasmid, and the negative control is nuclease-free water.

[0057] According to the sequence of the gag gene, the full-length primers SEQ ID No.4-F and SEQ ID No.4-R for amplifying the gag gene are designed. The gag gene was obtained by PCR and connected to the pMD18T vector to construct the pMD18T-GAG plasmid, and the correct pla...

Embodiment 3

[0059] Example 3 sample preparation

[0060] The kidney samples, lung samples, brain samples, liver samples and spleen samples of the sick fox were prepared respectively, and the sample preparation methods were as follows:

[0061] Take kidney, lung, brain, liver and spleen of sick fox, grind them with a grinder until crushed, freeze and thaw three times, centrifuge at 8000rpm for 5min, remove the precipitate, and take the supernatant for later use.

[0062] Further, the kidney samples, lung samples, brain samples, liver samples and spleen samples are marked as A, B, C, D, E, respectively, for use.

[0063] Among them, the fox retrovirus strain obtained from the kidney tissue of the sick fox was named PreXMRV-20, and the classification was named as gamma retrovirus; General Microbiology Center of Species Preservation Management Committee, the deposit number is CGMCC No.21898, address: No. 1, Beichen West Road, Chaoyang District, Beijing, postcode: 100101.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific primer group for fox retrovirus detection and application of a PCR detection kit. The specific primer group for fox retrovirus detection comprises two pairs of primers, wherein the first pair of primers is as follows: an upstream primer 1 is as shown in SEQ ID No.1-F, and a downstream primer 1 is as shown in SEQ ID No.1-R; the second pair of primers is as follows: an upstream primer 2 as shown in SEQ ID No.2-F, and a downstream primer 2 is as shown in SEQ ID No. 2-R. The application of the specific primer group in PCR detection is particularly the application of the specific primer group in the PCR detection kit. By using the specific primer group for fox retrovirus detection, the sensitivity and the specificity of PCR can be improved, the accuracy of fox retrovirus detection is further improved, a fox retrovirus can be rapidly and accurately detected by applying the specific primer group to the PCR detection kit, and the sample treatment process and the detection process are simple.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to the application of a specific primer set and a PCR kit for detection of fox retroviruses. Background technique [0002] The main goal of fox breeding is to produce fox fur, and the quality of fox fur directly affects the economic benefits of raising foxes. In recent years, fox retroviruses have caused fox dysplasia, kidney enlargement, and growth retardation in fox breeding. The disease is not obviously contagious, but the litter characteristics are obvious. Finally, it has a serious impact on the growth of foxes. The most intuitive impact is that the fox fur is small, the fur is rough and scarce, and the fox dies, resulting in a reduction or extinction of fox fur production. [0003] At present, there are no specific treatment and preventive measures for the above-mentioned diseases of foxes, making it difficult to prevent and control the disease. Under the current...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/702C12Q1/686C12Q2527/125C12Q2545/113
Inventor 王玉茂韩强于新友郭广君付石军庄金秋王建军沈志强
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com