Rabbit-derived recombinant monoclonal antibody for specifically recognizing type II grass carp reovirus VP4 protein, eukaryotic expression method and application

Abstract

The invention belongs to the technical field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody for specific recognition of type II grass carp reovirus VP4 protein, an eukaryotic expression method and application. According to the invention, a target gene S6 is transfected to an HEK293 cell for expression and purification, a New Zealand white rabbit is immunized in cooperation with a Freund's adjuvant, and the rabbit-derived recombinant monoclonal antibody capable of specifically recognizing the GCRV-II VP4 protein is obtained by using ELISA, single B cell screening and eukaryotic expression technologies. The antibody has strong specificity, provides support for further establishment of a specific II-type grass carp reovirus diagnosis technology, and has great application value in development of GCRV-II related scientific research.

Description

Technical Field

[0001] The present invention belongs to the technical fields of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody specifically recognizing the VP4 protein of grass carp reovirus type II, a eukaryotic expression method and applications thereof. Background Art

[0002] Grass carp reovirus (GCRV) is a member of aquatic reoviruses. Among them, GCRV-II can break out severely at all growth stages of grass carp, with a relatively high mortality rate, which can reach 60% - 90% or more in severe cases. Diseased fish can be divided into three types according to symptoms: "red muscle", "red intestine", and "red fin and red gill cover", and sometimes multiple symptoms may appear mixed. It has high infectivity and wide prevalence, and there is no effective drug treatment.

[0003] The GCRV-II virus particle is an icosahedron and is a double-stranded RNA virus. Its genome consists of 11 segmented RNAs, and each segment encodes a different protein. Among them, the S6 gene encodes the VP4 protein, which is the main structural protein of the virus, has high immunogenicity, and shows high conservation among different GCRV-II isolates.

[0004] A monoclonal antibody is an antibody produced by cloning a single B cell and targeting only a specific antigen epitope. Because of its high specificity and good affinity, it is widely used in the fields of diagnosis, treatment, and biology. Therefore, preparing a recombinant monoclonal antibody that recognizes the VP4 protein helps to deeply carry out research on grass carp reovirus type II and helps to establish corresponding detection methods.

[0005] Common monoclonal antibody screening methods mostly adopt hybridoma cell technology, which requires stages such as animal immunization, cell fusion, selective culture, screening of hybridoma cell clones, and large-scale preparation of monoclonal antibodies. And after purification, the monoclonal antibodies are paired in pairs to find specific monoclonal antibodies. The cycle is long, the technology is complex, and the cost is high. While single B cell screening can directly clone and express single antigen-specific B cells in vitro, retaining the natural pairing of the antibody light chain and the variable region of the heavy chain. The preparation process is simple and the preparation efficiency is high. Directly separating and screening at the single-cell level through flow cytometry to efficiently and accurately screen out B cells secreting the target antibody, and then combining with single-cell sequencing technology to obtain the target antibody sequence is a powerful and efficient and convenient technology for preparing monoclonal antibodies. Summary of the Invention

[0006] The object of the present invention is to provide a rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II. The variable region of the light chain of the monoclonal antibody is shown as SEQ ID NO.3, and the variable region of the heavy chain is shown as SEQ ID NO.1. The recombinant antibody gene has a clear structure, is highly specific, has strong stability, and is highly sensitive in multiple detection methods.

[0007] Another object of the present invention is to provide the application of the above monoclonal antibody in the preparation of a GCRV-II detection kit.

[0008] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0009] The applicant immunized New Zealand white rabbits with a GCRV-II VP4 immunogenic protein immunogen, performed immune boosting to generate sensitized B lymphocytes, collected specific cells using flow cytometry sorting technology, and used single B cell screening technology to screen for single B cells with high antibody titers and stable secretion, obtained single B cell RNA and prepared cDNA, amplified the coding genes of the heavy chain variable region and light chain variable region of the corresponding antibody, and used the obtained genes for recombinant expression in HEK293 cells, thereby obtaining a rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II. The amino acid sequence of the light chain variable region of the monoclonal antibody is shown as SEQ ID NO.3, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.1.

[0010] The protection scope of the present invention also includes the protein coding genes of the light chain variable region and heavy chain variable region of the above monoclonal antibody.

[0011] For the above-mentioned coding genes, preferably, the coding gene of the light chain variable region protein is shown as SEQ ID NO.4, and the coding gene of the heavy chain variable region protein is shown as SEQ ID NO.2.

[0012] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above coding gene combination.

[0013] The application of the above monoclonal antibody, coding gene or expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above coding gene in the preparation of a GCRV-II detection kit.

[0014] A rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II. The amino acid sequence of the light chain of the monoclonal antibody is shown as SEQ ID NO.8, and the amino acid sequence of the heavy chain is shown as SEQ ID NO.7.

[0015] The protein coding genes of the light chain and heavy chain of the above monoclonal antibody.

[0016] For the encoding gene described above, preferably, the encoding gene of the light chain protein is shown as SEQ ID NO.6, and the encoding gene of the heavy chain protein is shown as SEQ ID NO.5.

[0017] An expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above encoding gene combination.

[0018] Use of the above monoclonal antibody, encoding gene or expression cassette, recombinant vector, recombinant microorganism or in vitro recombinant cell having the above encoding gene in the preparation of a GCRV-II detection kit.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] Through single B cell antibody screening technology, the present invention obtains a rabbit-derived recombinant monoclonal antibody that can specifically recognize the VP4 protein of type II grass carp reovirus, with good specificity. First, an immunogen is obtained by using gene cloning and eukaryotic expression techniques. After boosting the immunization of healthy New Zealand white rabbits, antibodies with a high serum titer are obtained through ELISA and single B cell screening. According to single cell sequencing, the variable region sequences of the heavy and light chains of the antibody are obtained, and after amplification, eukaryotic expression is carried out to obtain a rabbit-derived recombinant monoclonal antibody with high specificity.

[0021] The recombinant monoclonal antibody provided by the present invention has a clear gene structure and strong stability. After eukaryotic expression, a large amount of recombinant monoclonal antibody can be obtained. Through IFA and Western Blot verification, it can not only specifically recognize the natural antigen in tissues, but also recognize the recombinant antigen well. It enriches the existing categories of grass carp antibodies and provides a material and theoretical basis for GCRV-II related research and diagnostic preparations. Description of the Drawings

[0022] Figure 1 SDS-PAGE verification results of the purified recombinant monoclonal antibody 1H1;

[0023] Among them: Lane 1 is the sample stock solution, 2 is the flow-through sample, 3 is the Marker, 4 is the washing solution, and 5-10 are the elution solutions.

[0024] Figure 2 Specificity identification diagram of the recombinant monoclonal antibody 1H1;

[0025] Figure 3 Immunofluorescence image of the recombinant monoclonal antibody 1H1 detecting grass carp brain tissue sections;

[0026] Among them: The upper figure is the infected tissue, and the lower figure is the negative tissue.

[0027] Figure 4Immunofluorescence image of recombinant monoclonal antibody 1H1 detecting cells;

[0028] Among them: The upper figure is the infected cells, and the lower figure is the negative cells. Detailed implementation manners

[0029] To more comprehensively understand and apply the present invention, the present invention will be further elaborated in detail below in combination with embodiments and drawings. The embodiments are only used to explain the present invention, rather than to limit the scope of the present invention. Without departing from the scope and spirit of the present invention, improvements or changes made to the specific implementation manners of the present invention all belong to the scope of the present invention.

[0030] In the following implementation cases, unless otherwise specified, they are all conventional practices; the reagents and materials used, unless otherwise specified, can be obtained from commercial channels.

[0031] Example 1:

[0032] Preparation of recombinant rabbit monoclonal antibody against grass carp GCRV-II-S6

[0033] 1.1 Cloning of GCRV-II S6 gene

[0034] Specific primers were designed using the S6 gene sequence of GCRV YX246 strain in GenBank (gene accession number: PQ553631.1). The specific primer sequences are as follows:

[0035] Forward primer: GAGCCTCTCCCTGTCTCCGGGTGCACCTGTGCCTGTGTCCGCTCTGAGAACCCCACCTGT, Reverse primer: TTATTAGCCAGAGGTCGAGGTCGGGTCAGGAAGGGGGGGGCCAGTATCTTGTCAGC TTGT.

[0036] Using the synthesized full-length gene as a template, the GCRV-II S6 gene fragment was amplified by PCR with the above primers. The pTT5 vector was linearized by double digestion with Hind III and BamH I. The target gene was ligated to the linearized vector and transformed into TOP10 competent cells. Positive plasmids containing the target gene were obtained through resistance screening and sequencing identification.

[0037] 1.2 Protein expression and purification

[0038] The above-obtained positive plasmid was transfected into HEK293 cells (1.5 - 2.0×10 6 cells / ml) for protein expression. The cells were cultured at 37 °C and 130 rpm / min for 6 days. The culture medium supernatant was collected, centrifuged at high speed, and then filtered through a 0.22 μm filter membrane.

[0039] The Protein A affinity chromatography column was pre-equilibrated with PBS, and then the culture medium supernatant after filtration was bound to Protein A. Washing solution (PBS, pH = 7.4) was added for washing until no protein flowed out. Then, elution solution (0.1 M glycine, pH = 3.0) was added for washing until no protein flowed out. Finally, neutralization solution (1 M Tris-Cl, pH = 8.5) was added for washing until no protein flowed out.

[0040] The above eluate samples were collected to obtain the recombinant protein VP4. SDS-PAGE was performed to detect the protein purity. The detection result was consistent with the predicted size of the target protein, and the concentration was 1.195 mg / ml.

[0041] 1.3 Immunizing animals

[0042] Healthy 4-month-old female New Zealand white rabbits were taken, and the recombinant protein prepared in step 1.2 was used as the immunogen to immunize the New Zealand white rabbits. The specific immunization procedure was as follows:

[0043] The recombinant protein (200 μg) was fully mixed and emulsified with an equal volume of Freund's complete adjuvant, and then injected subcutaneously at multiple points in the white rabbits. After 14 days, it was boosted 4 times at intervals of 14 days. When boosting, the recombinant protein (200 μg) was fully mixed and emulsified with an equal volume of Freund's incomplete adjuvant, and the same dose was used for subcutaneous multi-point injection in the white rabbits. On the 7th day after the 3rd boost, blood was collected from the marginal ear vein to obtain serum for ELISA detection. Finally, on the 7th day after the 4th boost, carotid artery blood was collected, and the serum was taken after standing overnight at 4°C.

[0044] 1.4 Detection of antiserum titer

[0045] The GCRV-II recombinant VP4 protein obtained in the above step 1.2 was diluted to 2 μg / ml with 0.05 mol / L carbonate (pH = 9.6) and used as an antigen to coat an ELISA plate. 100 μl was added to each well and incubated overnight at 4°C; the antigen was discarded, and the ELISA plate was washed 3 times with PBST containing 0.05% Tween-20 for 3 minutes each time. 150 μl of PBST containing 5% skim milk powder was added to each well and blocked at 37°C for 1 hour; the blocking solution was discarded, and the ELISA plate was washed 3 times with PBST for 3 minutes each time. The collected sera were diluted at 1:1000 respectively and then serially diluted. 100 μl was added to each well and incubated at 37°C for 1 hour. At the same time, rabbit polyclonal serum was set as a positive control and PBS as a negative control; the antibody was discarded, and the ELISA plate was washed 3 times with PBST for 3 minutes each time. Horseradish peroxidase-labeled goat anti-rabbit IgG (H+L) (Jackson) was diluted at 1:8000 as a secondary antibody. 100 μl was added to each well and incubated at 37°C for 45 minutes; the antibody was discarded, and the ELISA plate was washed 5 times with PBST for 3 minutes each time. 100 μl of substrate solution (TMB) was added to each well and reacted for 5 - 10 minutes. Finally, 100 μl of 2 mol / L sulfuric acid was added to each well to terminate the reaction; then the OD value was detected, and the OD value at a wavelength of 450 nm was measured using an enzyme-linked immunosorbent assay reader (Kehua ST-360).

[0046] The result was obtained that the antibody titer after purification was ≥128000.

[0047] 1.5 Single B cell screening

[0048] The B cells of white rabbits' spleens were isolated. The cells were washed 2 times, with the volume of the washing solution being 50 ml each time, centrifuged at 1500 rpm for 5 minutes, the supernatant was discarded, and the B cells were collected. Using flow cytometry, the collected B cells were incubated with specific antibodies, and flow cytometry sorting was performed. The obtained specific B cells were counted and serially diluted. The cells were plated on a 96-well plate and cultured with a culture medium (Maisi Bio). On the 15th day, the supernatant was taken and detected by ELISA according to the method in the above step 1.4 to detect the antibody titer of the supernatant corresponding to each strain of B cells. Finally, the antibody 1H1 with the highest titer (underlined) was obtained. The detection results are shown in Table 1:

[0049] Table 1. Binding titers of specific B cell antibodies and recombinant VP4 protein detected by ELISA

[0050]

[0051]

[0052] The single B cells corresponding to antibody 1H1 were sequenced. After extracting the cellular RNA, it was reverse transcribed into cDNA and amplified. The upstream primer for the heavy chain (including the constant region and variable region) amplification was: GGTACCGAGCTCGGATCCATGGAGACTG; the downstream primer for the heavy chain amplification was: GCTGGATATCTGCAGAATTCTCATTTACCC; the amplified heavy chain gene sequence was as shown in SEQ ID NO.5, containing the heavy chain variable region shown in SEQ ID NO.2; the upstream primer for the light chain (including the constant region and variable region) amplification was: GGTACCGAGCTCGGATCCATGGACACGA; the downstream primer for the light chain amplification was: CACTGTGCTGGATATCTGCAGAATTCTCAGCAGTCA, and the amplified light chain gene sequence was as shown in SEQ ID NO.6, containing the light chain variable region shown in SEQ ID NO.4.

[0053] 1.6 Preparation of recombinant monoclonal antibody

[0054] To obtain the recombinant monoclonal antibody, the heavy chain gene and light chain gene amplified in step 1.5 above were respectively ligated to the positions of BamH I or ECOR I of the mammalian expression vector pcDNA3.1 by homologous recombination. The specific method was as follows: First, the vector pcDNA3.1 was digested with enzymes. The digestion system was: 1 μg of pcDNA3.1, 5 μl of digestion buffer, 2 μl of BamH I or 2 μl of EcoR I; reaction conditions: 37 °C, 60 minutes. After digestion, it was respectively recombinantly ligated with the antibody heavy chain or antibody light chain. The ligation system was: 4 μl of pcDNA3.1, 10 μl of recombinant enzyme, and 6 μl of the PCR products of the antibody heavy chain or antibody light chain respectively; the ligation was completed in a 52 °C water bath for 40 minutes. At the same time, verification was carried out. The expression vector pcDNA3.1 carrying the full-length heavy chain gene after recombination, and the expression vector pcDNA3.1 carrying the full-length light chain gene were respectively double digested with BamHI and EcoRI for verification to ensure that the recombinant plasmid was correct. At the same time, the constructed plasmid was verified by sequencing to ensure that the inserted target antibody sequence was correct.

[0055] The successfully constructed expression vectors were co-transfected into HEK293 cells. After culturing the cells for 6 days, the cell culture supernatant was collected for protein purification. The specific steps of protein expression and purification referred to step 1.2 above to obtain the recombinant monoclonal antibody 1H1. Among them, 45 mg of antibody was obtained from 1 L of cell culture medium. At the same time, the antibody titer was detected. After diluting the antibody in proportion, it was detected by the ELISA method in step 1.4 above. The OD values obtained at different dilution multiples are shown in Table 2, and the monoclonal antibody titer ≥ 128000.

[0056] Table 2. Binding titer of recombinant monoclonal antibody 1H1 and recombinant VP4 protein detected by ELISA

[0057] Dilution factor OD value Dilution factor OD value 2000 1.277 32000 0.898 4000 1.244 64000 0.65 8000 1.136 128000 0.422 16000 1.044 Black 0.06

[0058] Example 2:

[0059] Reactivity of rabbit-derived recombinant monoclonal antibody 1H1 with grass carp reovirus type II

[0060] 2.1 Detection by Western blot (WB)

[0061] Extract the protein from the grass carp brain tissue infected with grass carp reovirus type II, prepare the sample and perform Western blot. The primary antibody used is the rabbit-derived recombinant monoclonal antibody 1H1 (1:1000) prepared in Example 1, incubated at room temperature for 1 hour, washed 4 times with PBST for 5 minutes each time, the secondary antibody used is HRP-labeled goat anti-rabbit IgG (H+L) (1:10000), incubated at room temperature for 40 minutes, washed 4 times with PBST, and finally developed and observed. At the same time, set the sample incubated with rabbit IgG as the primary antibody as the negative control.

[0062] The WB results are as Figure 2 shown, indicating that the rabbit-derived recombinant monoclonal antibody 1H1 prepared by the present invention can specifically recognize the VP4 protein of grass carp reovirus type II.

[0063] 2.2 Detection by immunofluorescence (IF):

[0064] Perform immunofluorescence analysis on the grass carp intestinal tissue sections infected with grass carp reovirus type II using the rabbit-derived recombinant monoclonal antibody 1H1 prepared in Example 1. Specifically:[[]]

[0065] After the fixed tissue sections are repaired with the repair solution, wash them 2 times with PBS for 5 minutes each time; after drying, use a histochemical pen to draw a circle on the glass slide, add 0.3% Triton X-100 to each circle to permeabilize for 15 minutes, wash 2 times with PBS for 5 minutes each time, and then add the blocking solution and incubate for 30 minutes; the primary antibody is the rabbit-derived recombinant monoclonal antibody 1H1 (1:100) prepared in Example 1, and at the same time set the healthy grass carp intestinal tissue sections as the negative control, incubate overnight at 4°C, wash 4 times with PBS for 5 minutes each time; the secondary antibody is Cy3-labeled goat anti-rabbit IgG (H+L), incubate at room temperature in the dark for 40 minutes, wash 4 times with PBS for 5 minutes each time; stain the cell nuclei with DAPI dye (1:10) for 8 minutes, wash 2 times with PBS for 5 minutes each time; after sealing with an anti-fluorescence mounting medium, observe the fluorescence with a fluorescence microscope.

[0066] The IFA results are as Figure 3As shown, it indicates that the rabbit-derived recombinant monoclonal antibody 1H1 of the present invention can recognize Grass Carp Reovirus type II in infected tissues.

[0067] 2.3 Immunofluorescence assay of cells:

[0068] CIK cells were seeded into confocal culture dishes. After standing for adherence and when the cells grew confluent, they were challenged with GCRV-II. After 48 hours, the culture medium was aspirated, and the cells were fixed with 4% paraformaldehyde solution. After discarding the fixative, blocking, antibody incubation, etc. were carried out according to the detection steps in 2.2 above. At the same time, non-challenged CIK cells were set as negative controls.

[0069] The results are as Figure 4 shown, the rabbit-derived recombinant monoclonal antibody 1H1 of the present invention can recognize Grass Carp Reovirus type II in infected cells.

[0070] The above are only the preferred embodiments of the present invention, and the protection scope of the present invention is not limited thereto. It should be noted that for those of ordinary skill in the art of this technology, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be regarded as within the protection scope of the present invention.

Claims

1. A rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II, wherein the amino acid sequence of the light chain variable region of the monoclonal antibody is as shown in SEQ ID NO.3, and the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO.

1.

2. The coding genes of the proteins of the light chain variable region and the heavy chain variable region of the monoclonal antibody according to claim 1.

3. According to the coding gene of claim 2, the coding gene of the light chain variable region protein is as shown in SEQ ID NO.4, and the coding gene of the heavy chain variable region protein is as shown in SEQ ID NO.

2.

4. An expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene of claim 2.

5. Use of the monoclonal antibody of claim 1, the coding gene of claim 2, or an expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene of claim 2 in the preparation of a GCRV-II detection kit.

6. A rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II, wherein the amino acid sequence of the light chain of the monoclonal antibody is as shown in SEQ ID NO.8, and the amino acid sequence of the heavy chain is as shown in SEQ ID NO.

7.

7. The coding genes of the proteins of the light chain and the heavy chain of the monoclonal antibody according to claim 6.

8. According to the coding gene of claim 7, the coding gene of the light chain protein is as shown in SEQ ID NO.6, and the coding gene of the heavy chain protein is as shown in SEQ ID NO.

5.

9. An expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene of claim 7.

10. Use of the monoclonal antibody of claim 1, the coding gene of claim 7, or an expression cassette, recombinant vector, recombinant microorganism or isolated recombinant cell having the coding gene of claim 7 in the preparation of a GCRV-II detection kit.

Images