A rabbit-derived recombinant monoclonal antibody specifically recognizing VP4 protein of grass carp reovirus type II, a eukaryotic expression method and application thereof

Abstract

The application belongs to the technical field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, a eukaryotic expression method and application. The S6 gene in GCRV-II encodes VP4 protein, the application transfects the target gene S6 into HEK293 cells for expression and purification, cooperates with Freund's adjuvant to immunize New Zealand white rabbits, and uses ELISA, single B cell screening and eukaryotic expression technology to obtain a rabbit-derived recombinant monoclonal antibody specifically recognizing GCRV-II VP4 protein. The antibody has strong specificity, provides support for further establishment of specific type II grass carp reovirus diagnosis technology, and has great application value for development of GCRV-II related scientific research.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of immunology and in vitro diagnosis, and particularly relates to a rabbit-derived recombinant monoclonal antibody specifically recognizing VP4 protein of type II grass carp reovirus, a eukaryotic expression method and application. BACKGROUND

[0002] Grass carp reovirus (GCRV) is a member of aquatic reovirus, and GCRV-II can break out seriously in each growth stage of grass carp, with a high mortality rate of 60% to 90% or more. The dead fish can be divided into three types of "red muscle", "red intestine", "red fin and red gill cover" according to symptoms, and sometimes mixed symptoms appear. It has high infectivity and wide prevalence, and there is no effective drug treatment.

[0003] The GCRV-II virion is a regular icosahedron, which is a double-stranded RNA virus. The genome is composed of 11 segmented RNAs, each of which encodes different proteins. Among them, S6 gene encodes VP4 protein, which is the main structural protein of the virus and has high immunogenicity. It shows high conservation in different GCRV-II isolates.

[0004] Monoclonal antibody is an antibody produced by a single B cell clone only for a certain antigen epitope. It is widely used in diagnosis, treatment and biological field due to its high specificity and good affinity. Therefore, preparation of recombinant monoclonal antibody recognizing VP4 protein helps to further carry out research on type II grass carp reovirus and help to establish the corresponding detection method.

[0005] Common monoclonal antibody screening methods mostly use hybridoma cell technology, which needs to go through stages of animal immunization, cell fusion, selection culture, hybridoma cell clone screening and large-scale preparation of monoclonal antibody. After purification, the monoclonal antibody is paired two by two to find specific monoclonal antibody, which has long cycle, complex technology and high cost. Single B cell screening can directly clone and express single antigen-specific B cell in vitro, retain the natural pairing of antibody light chain and antibody heavy chain variable region, and has simple preparation process and high preparation efficiency. Through flow cytometry sorting technology, B cells secreting target antibody are efficiently and accurately screened at single cell level, and then single cell sequencing technology is combined to obtain target antibody sequence, which is a powerful and efficient technology for preparing monoclonal antibody. SUMMARY

[0006] The application aims to provide a rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, wherein the light chain variable region of the monoclonal antibody is shown as SEQ ID NO. 3, and the heavy chain variable region is shown as SEQ ID NO. 1. The recombinant antibody has a clear gene structure, high specificity, strong stability, and high sensitivity in multiple detection methods.

[0007] Another purpose of the application is to provide the application of the above monoclonal antibody in the preparation of a GCRV-II detection kit.

[0008] In order to achieve the above-mentioned purpose, the technical scheme provided by the application is as follows:

[0009] The applicant immunizes a New Zealand white rabbit by preparing a GCRV-II VP4 immunogen protein immunogen, produces sensitized B lymphocytes, collects specific cells by using flow cytometry sorting technology, screens single B cells by using single B cell screening technology, and obtains single B cell RNA and prepares cDNA to amplify the coding genes of the heavy chain variable region and the light chain variable region of the corresponding antibody. The obtained genes are used for recombinant expression of HEK293 cells, so as to obtain a rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, wherein the amino acid sequence of the light chain variable region of the monoclonal antibody is shown as SEQ ID NO. 3, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1.

[0010] The protection scope of the application also includes the coding genes of the light chain variable region and the heavy chain variable region of the above-mentioned monoclonal antibody.

[0011] The coding genes are preferably the coding gene of the light chain variable region protein shown as SEQ ID NO. 4, and the coding gene of the heavy chain variable region protein shown as SEQ ID NO. 2.

[0012] The expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the above-mentioned coding gene combination.

[0013] The application of the above-mentioned monoclonal antibody, the coding gene or the expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the above-mentioned coding gene in the preparation of a GCRV-II detection kit.

[0014] A rabbit-derived recombinant monoclonal antibody specifically recognizing type II grass carp reovirus VP4 protein, wherein the amino acid sequence of the light chain of the monoclonal antibody is shown as SEQ ID NO. 8, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 7.

[0015] The coding genes of the light chain and the heavy chain of the above-mentioned monoclonal antibody.

[0016] The coding gene of the above-mentioned, preferably the coding gene of the light chain protein is shown in SEQ ID NO. 6, and the coding gene of the heavy chain protein is shown in SEQ ID NO. 5.

[0017] The expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell with the above-mentioned combination of coding genes.

[0018] The above-mentioned monoclonal antibody, coding gene or expression cassette, recombinant vector, recombinant microorganism or ex vivo recombinant cell with the above-mentioned coding gene is used for preparing a GCRV-II detection kit.

[0019] Compared with the prior art, the application has the following beneficial effects:

[0020] The application obtains a rabbit-derived recombinant monoclonal antibody capable of specifically recognizing the VP4 protein of grass carp reovirus type II through single B cell antibody screening technology, and the antibody has good specificity. First, an immunogen is obtained through gene cloning and eukaryotic expression technology, and the immunogen is used for immunizing a healthy New Zealand white rabbit. After the immunization, an antibody with a high serum titer is obtained through ELISA and single B cell screening. According to single cell sequencing, the variable region sequences of the heavy chain and the light chain of the antibody are obtained. After amplification, the eukaryotic expression is performed to obtain the rabbit-derived recombinant monoclonal antibody with high specificity.

[0021] The recombinant monoclonal antibody provided by the application has a clear gene structure and high stability. After eukaryotic expression, a large amount of recombinant monoclonal antibody can be obtained. Through IFA and Western Blot verification, the recombinant monoclonal antibody can specifically recognize the natural antigen in the tissue and can also well recognize the recombinant antigen. The application enriches the existing types of grass carp antibodies, and provides a material and theoretical basis for GCRV-II related research and diagnostic preparations. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 SDS-PAGE verification result of the recombinant monoclonal antibody 1H1 after purification;

[0023] In the drawings, lane 1 is a sample stock solution, lane 2 is a flow-through sample, lane 3 is a marker, lane 4 is a washing solution, and lanes 5-10 are eluents.

[0024] Figure 2 Specificity identification diagram of the recombinant monoclonal antibody 1H1;

[0025] Figure 3 Immunofluorescence diagram of the recombinant monoclonal antibody 1H1 detecting grass carp brain tissue sections;

[0026] In the drawings, the upper diagram is an infected tissue, and the lower diagram is a negative tissue.

[0027] Figure 4The immunofluorescence image of the cell detected by the recombinant monoclonal antibody 1H1;

[0028] In the above figure, the upper image is an infected cell, and the lower image is a negative cell. DETAILED DESCRIPTION

[0029] In order to more fully understand and apply the present application, the present application will be further described in detail below with reference to the examples and accompanying drawings, which are only used to explain the present application, and are not used to limit the scope of the present application. Improvements or changes made to the specific embodiments of the present application, without departing from the scope and spirit of the present application, all belong to the scope of the present application.

[0030] In the following implementation cases, if no special instructions are given, they are all routine practices; the reagents and materials used, if no special instructions are given, can be obtained from commercial channels.

[0031] Example 1:

[0032] Preparation of anti-Grass GCRV-II-S6 recombinant rabbit monoclonal antibody

[0033] 1.1 Cloning of GCRV-II S6 gene

[0034] Specific primers were designed using the S6 gene sequence of GCRV YX246 strain in GenBank (Gene Accession No. PQ553631.1), and the obtained primer sequences are as follows:

[0035] The upstream primer is GAGCCTCTCCCTGTCTCCGGGTGCACCTGTGCCTGTGTCCGCTCTGAGAACCCCACCTGT, and the downstream primer is TTATTAGCCAGAGGTCGAGGTCGGGTCAGGAAGGGGGGGGCCAGTATCTTGTCAGC TTGT.

[0036] The synthesized full-length gene was used as a template to PCR amplify the GCRV-II S6 gene fragment using the above primers. The pTT5 vector was linearized by double digestion with Hind III and BamH I, the target gene was ligated with the linearized vector, and the positive plasmid containing the target gene was obtained by transforming the TOP10 competent cells, resistance screening and sequencing identification.

[0037] 1.2 Protein expression and purification

[0038] The above obtained positive plasmid was transfected into HEK293 cells (1.5-2.0×10 6 cells / ml) for protein expression, which was cultured at 37℃, 130 rpm / min for 6 days, and the culture supernatant was collected after high-speed centrifugation and 0.22 μm filtration.

[0039] The Protein A affinity chromatography column was previously equilibrated with PBS, then the culture supernatant after filtration was combined with Protein A, and a washing solution (PBS, pH = 7.4) was added to wash until no protein flowed out, then an elution solution (0.1 M glycine, pH = 3.0) was added to wash until no protein flowed out, and finally a neutralizing solution (1 M Tris-Cl, pH = 8.5) was added to wash until no protein flowed out.

[0040] The above elution sample was collected to obtain recombinant protein VP4, and SDS-PAGE was performed to detect the purity of the protein. The detection result was consistent with the predicted size of the target protein, and the concentration was 1.195 mg / ml.

[0041] 1.3 Immunization of animals

[0042] A 4-month-old healthy female New Zealand white rabbit was taken, and the recombinant protein prepared in step 1.2 was used as an immunogen to immunize the New Zealand white rabbit. The specific immunization procedure was as follows:

[0043] The recombinant protein (200 μg) was mixed and emulsified with an equal volume of Freund's complete adjuvant, and was injected subcutaneously in multiple points of the rabbit. Fourteen days later, the rabbit was boosted four times, with an interval of 14 days each time. For the booster, the recombinant protein (200 μg) was mixed and emulsified with an equal volume of Freund's incomplete adjuvant, and was injected subcutaneously in multiple points of the rabbit using the same dose. Seven days after the third booster, the ear marginal vein blood of the rabbit was collected to obtain serum for ELISA detection. Seven days after the last fourth booster, the carotid artery blood of the rabbit was collected, and the serum was obtained after overnight standing at 4°C.

[0044] 1.4 Detection of antiserum titer

[0045] The GCRV-II recombinant VP4 protein obtained in step 1.2 above was diluted to 2 μg / ml with 0.05 mol / L carbonate (pH = 9.6) as an antigen to coat an ELISA plate, 100 μl was added to each well, and incubated overnight at 4°C; the antigen was discarded, the ELISA plate was washed with PBST containing 0.05% Tween-20 for 3 times, 3 minutes each time, 150 μl of PBST containing 5% skimmed milk powder was added to each well, and blocked at 37°C for 1 hour; the blocking solution was discarded, the ELISA plate was washed with PBST for 3 times, 3 minutes each time, the collected serum was diluted according to 1:1000, and then diluted by doubling, 100 μl was added to each well, and incubated at 37°C for 1 hour. At the same time, rabbit polyclonal serum was set as a positive control, and PBS was set as a negative control; the antibodies were discarded, the ELISA plate was washed with PBST for 3 times, 3 minutes each time, horseradish enzyme-labeled goat anti-rabbit IgG (H+L) (Jackson) was diluted according to 1:8000 as a secondary antibody, 100 μl was added to each well, and incubated at 37°C for 45 minutes; the antibodies were discarded, the ELISA plate was washed with PBST for 5 times, 3 minutes each time, 100 μl of substrate solution (TMB) was added to each well, and reacted for 5-10 minutes, finally 100 μl of 2 mol / L sulfuric acid was added to each well to stop the reaction; then the OD value was detected, and the OD value at 450 nm wavelength was determined using an enzyme marker (Kewei ST-360).

[0046] The results showed that the antibody titer after purification was ≥128000.

[0047] 1.5 Single B cell screening

[0048] The white rabbit spleen B cells were separated, the cells were washed 2 times, 50 ml of washing solution was used each time, centrifuged at 1500 rpm for 5 minutes, the supernatant was discarded, and the B cells were collected. Flow cytometry was used to incubate specific antibodies with the collected B cells, flow cytometry sorting was performed, the specific B cells obtained were counted and subjected to limited dilution, the cells were plated in a 96-well plate, and cultured by using a culture medium (Mabisolubio), the supernatant was taken at day 15, and ELISA detection was performed according to the method in step 1.4 above, the antibody titer of the supernatant corresponding to each strain of B cells was detected, and finally the antibody 1H1 with the highest titer (underlined) was obtained, and the detection results are shown in Table 1:

[0049] Table 1. ELISA detection of the binding titer of specific B cell antibodies and recombinant VP4 protein

[0050]

[0051]

[0052] The single B cell corresponding to antibody 1H1 is sequenced, after extracting cell RNA, reverse transcribing into cDNA, and amplifying, wherein the heavy chain (including constant region and variable region) amplification upstream primer is: GGTACCGAGCTCGGATCCATGGAGACTG; the heavy chain amplification downstream primer is: GCTGGATATCTGCAGAATTCTCATTTACCC; the amplified heavy chain gene sequence is shown in SEQ ID NO. 5, containing the heavy chain variable region shown in SEQ ID NO. 2; the light chain (including constant region and variable region) amplification upstream primer is: GGTACCGAGCTCGGATCCATGGACACGA; the light chain amplification downstream primer is: CACTGTGCTGGATATCTGCAGAATTCTCAGCAGTCA, and the amplified light chain gene sequence is shown in SEQ ID NO. 6, containing the light chain variable region shown in SEQ ID NO. 4.

[0053] 1.6 Preparation of recombinant monoclonal antibody

[0054] In order to obtain the recombinant monoclonal antibody, the amplified heavy chain gene and light chain gene in the above step 1.5 are respectively connected to the position of BamH I or ECOR I of the mammalian expression vector pcDNA3.1 by the method of homologous recombination, and the specific method is as follows: first, the vector pcDNA3.1 is subjected to enzyme digestion, and the enzyme digestion system is: pcDNA3.1 1 μg, enzyme digestion buffer 5 μl, BamH I 2 μl or EcoR I 2 μl; the reaction condition is: 37°C, 60 minutes. After enzyme digestion, recombination connection is carried out with the antibody heavy chain or the antibody light chain, and the connection system is: pcDNA3.1 4 μl, recombination enzyme 10 μl, and the PCR product of the antibody heavy chain or the antibody light chain is 6 μl respectively; the connection is completed at 52°C water bath for 40 minutes. At the same time, verification is carried out, and the expression vector pcDNA3.1 carrying the full-length gene of the heavy chain and the expression vector pcDNA3.1 carrying the full-length gene of the light chain are respectively subjected to double enzyme digestion with BamHI and EcoRI to determine that the recombination constructed plasmid is correct, and the constructed plasmid is subjected to sequencing verification to determine that the inserted target antibody sequence is correct.

[0055] The successfully constructed expression vectors are co-transfected into HEK293 cells, and after the cells are cultured for 6 days, the cell culture supernatant is collected for protein purification. The steps of protein expression and purification are referred to the above step 1.2, and the recombinant monoclonal antibody 1H1 is obtained, wherein the 1L cell culture solution obtains 45 mg of antibody. At the same time, the antibody titer is detected, the antibody is diluted according to the proportion, and the detection is carried out according to the ELISA method in the above step 1.4. The OD values obtained at different dilution multiples are shown in Table 2, and the monoclonal antibody titer is ≥128000.

[0056] Table 2. ELISA detection of the binding titer of recombinant monoclonal antibody 1H1 to recombinant VP4 protein

[0057] Dilution factor OD value Dilution factor OD value 2000 1.277 32000 0.898 4000 1.244 64000 0.65 8000 1.136 128000 0.422 16000 1.044 Black 0.06

[0058] Example 2:

[0059] Reactivity of rabbit-derived recombinant monoclonal antibody 1H1 with grass carp reovirus type II

[0060] 2.1 Western blot (WB) detection

[0061] Proteins were extracted from the brain tissue of grass carp infected with grass carp reovirus type II, the sample was prepared and subjected to Western blot, the primary antibody was rabbit-derived recombinant monoclonal antibody 1H1 prepared in Example 1 (1:1000), incubated at room temperature for 1 hour, washed with PBST 4 times, each for 5 minutes, the secondary antibody was HRP-labeled goat anti-rabbit IgG (H+L) (1:10000), incubated at room temperature for 40 minutes, washed with PBST 4 times, and finally developed and observed. A sample incubated with rabbit IgG as the primary antibody was set as a negative control.

[0062] The WB results are shown in Figure 2 , indicating that the rabbit-derived recombinant monoclonal antibody 1H1 prepared in the application can specifically recognize the VP4 protein of grass carp reovirus type II.

[0063] 2.2 Immunofluorescence (IF) detection:

[0064] The rabbit-derived recombinant monoclonal antibody 1H1 prepared in Example 1 was used for immunofluorescence analysis of the intestinal tissue sections of grass carp infected with grass carp reovirus type II, specifically:

[0065] After the fixed tissue sections were repaired with a repair solution, they were washed with PBS 2 times, each for 5 minutes; after drying, a circle was drawn on the glass slide using a histological pen, 0.3% Triton X-100 was added to each circle to break the membrane for 15 minutes, and then washed with PBS 2 times, each for 5 minutes, and then blocking solution was added for 30 minutes; the primary antibody was rabbit-derived recombinant monoclonal antibody 1H1 prepared in Example 1 (1:100), and healthy grass carp intestinal tissue sections were set as negative controls, incubated at 4°C overnight, washed with PBS 4 times, each for 5 minutes; the secondary antibody was Cy3-labeled goat anti-rabbit IgG (H+L), incubated at room temperature in the dark for 40 minutes, washed with PBS 4 times, each for 5 minutes; DAPI dye (1:10) was used to stain the cell nucleus for 8 minutes, washed with PBS 2 times, each for 5 minutes; after sealing with an anti-fluorescence sealing agent, the fluorescence was observed under a fluorescence microscope.

[0066] The IFA results are shown in Figure 3As shown, the rabbit-derived recombinant monoclonal antibody 1H1 described in this invention can recognize type II grass carp reovirus in infected tissues.

[0067] 2.3 Cell immunofluorescence detection:

[0068] CIK cells were seeded onto confocal culture dishes and allowed to adhere statically until they reached confluence. They were then challenged with GCRV-II. After 48 hours, the culture medium was aspirated, and the cells were fixed with 4% paraformaldehyde solution. After discarding the fixative, the cells were blocked and incubated with antibodies according to the detection steps described in 2.2 above. Unchallenged CIK cells were used as a negative control.

[0069] The results are as follows Figure 4 As shown, the rabbit-derived recombinant monoclonal antibody 1H1 described in this invention can recognize type II grass carp reovirus in infected cells.

[0070] The above description is merely a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited thereto. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II, wherein the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID NO.3 and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

1.

2. The gene encoding the protein of the light chain variable region and the heavy chain variable region of the monoclonal antibody according to claim 1.

3. The coding gene according to claim 2, wherein the coding gene for the light chain variable region protein is shown in SEQ ID NO.4, and the coding gene for the heavy chain variable region protein is shown in SEQ ID NO.

2.

4. An expression cassette, recombinant vector, recombinant microorganism, or ex vivo recombinant cell having the gene encoding as described in claim 2.

5. The use of the monoclonal antibody of claim 1, the encoding gene of claim 2 or an expression cassette having the encoding gene of claim 2, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell in the preparation of a type II grass carp reovirus detection kit.

6. A rabbit-derived recombinant monoclonal antibody that specifically recognizes the VP4 protein of grass carp reovirus type II, wherein the amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO.8 and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

7.

7. The encoding genes of the light chain and heavy chain proteins of the monoclonal antibody of claim 6.

8. The coding gene according to claim 7, wherein the coding gene for the light chain protein is shown in SEQ ID NO. 6, and the coding gene for the heavy chain protein is shown in SEQ ID NO.

5.

9. An expression cassette, recombinant vector, recombinant microorganism, or ex vivo recombinant cell having the gene encoding claim 7.

10. The use of the monoclonal antibody of claim 6, the encoding gene of claim 7 or an expression cassette having the encoding gene of claim 7, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell in the preparation of a grass carp reovirus detection kit.

Images