Soybean nodule number related major single nucleotide polymorphic site and application thereof

Abstract

The invention discloses a soybean nodulation number related major single nucleotide polymorphism (SNP) site and application thereof, the SNP site is positioned on a soybean chromosome 2, the physical distance of the SNP site in a soybean genome version number Glycine max Wm82.a2.v1 is Chr0243129492, the SNP site corresponds to a 20th basic group of a sequence shown as SEQ ID NO.1, when the site is T / T homozygosis, the corresponding genotype is A, when the site is T / T homozygosis, the corresponding genotype is B, and when the site is T / T homozygosis, the corresponding genotype is C; when the site is C / C homozygous, the corresponding genotype is B; the number of root nodules is as follows: the genotype A homozygous soybean is greater than or candidate to be greater than that of the genotype B homozygous soybean. By detecting the SNP, a tested soybean population can be accurately divided into a low root nodule number (C / C) and a high root nodule number (T / T). Therefore, the molecular marker can be used as a basis for preliminarily identifying the number of soybean nodules, has high efficiency and applicability such as simplicity in operation, low cost and short consumed time, and has important values for digging germplasm of high-nodulation soybeans, solving the problem of nitrogen fertilizer abuse and promoting sustainable development of agriculture.

Description

Technical Field

[0001] The invention relates to the field of molecular biotechnology, in particular to soybean nodule number-related major effect single nucleotide polymorphism sites and applications thereof. Background Art

[0002] Soybean (Glycine max L.Merr.) is native to China and is one of the country's important oil crops. It is also the main source of protein and vegetable oil. Nitrogen is essential for crop growth. The irrational application of nitrogen fertilizer in modern agriculture leads to environmental problems such as soil compaction, acidification, and eutrophication of water bodies, which seriously affects the sustainable development of agriculture. As a typical leguminous plant, soybean can effectively increase yield through symbiotic nitrogen fixation with rhizobia, while reducing the use of nitrogen fertilizers and alleviating environmental pollution. Symbiotic nitrogen fixation between soybean and rhizobia is one of the effective ways to solve the problem of nitrogen fertilizer abuse and improve its utilization rate.

[0003] Soybean nodulation traits are regulated by multiple genes. Mining the genetic loci or genes that regulate symbiotic nodulation is of great significance for improving the efficiency of soybean symbiotic nitrogen fixation and molecular assisted breeding. In recent years, with the vigorous development of biotechnology, many genes and quantitative trait loci (QTL, Quantitative Trait Locus) related to soybean symbiotic nitrogen fixation have been located. The SoyBase (http: / / www.soybase.org / ) database contains a total of 68 QTLs related to soybean symbiotic nitrogen fixation, which are mainly distributed on chromosomes 6, 10 and 11. However, traits related to soybean symbiotic nitrogen fixation, such as nodule number, nodule dry weight, and nodule size, are complex quantitative traits. The QTL positioning method for studying soybean symbiotic nitrogen fixation-related traits has certain limitations in terms of large confidence intervals and applicable positioning populations. In recent years, genome-wide association studies (GWAS) have been widely used in linkage marker development and gene mining, and there have been a lot of studies on the study of soybean symbiotic nodulation and nitrogen fixation.

[0004] Although there have been many studies on the positioning of QTLs and candidate gene mining related to soybean nodulation, soybean symbiotic nitrogen fixation is a complex process regulated by multiple genes and is greatly affected by materials and environment. The nodulation phenotypes of soybean varieties suitable for planting in different regions are not the same. Therefore, the development and identification of molecular markers closely linked to the nodulation trait and further application development based on this have important theoretical research significance and practical application value. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a major effect single nucleotide polymorphism site related to soybean nodule number and an application thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] A SNP site associated with the number of soybean nodules, the SNP site is located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycine max Wm82.a2.v1 is Chr02_43129492, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the size of the nodule number is: the soybean homozygous for genotype A is greater than or is candidate greater than the soybean homozygous for genotype B.

[0008] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in identifying the quantitative trait of soybean nodulation, which is used to detect the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, and the reagent or kit contains a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0009] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: a primer combination consisting of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, 2T-FAM, 2T-VIC and 2T-R.

[0010] A primer combination is used to detect the single nucleotide polymorphism of the following SNP site in the soybean genome, the SNP site is located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycine maxWm82.a2.v1 is Chr02_43129492, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the size of the nodule number is: the soybean homozygous for the genotype A is greater than or a candidate is greater than the soybean homozygous for the genotype B; the primer combination is a primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 in the sequence list; this primer combination is used to detect the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1.

[0011] Application of the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1 in soybean molecular marker-assisted selection breeding.

[0012] The SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1 is used in the initial screening, and / or rescreening, and / or identification, and / or classification, and / or auxiliary identification of soybean nodule number in the early stage of soybean molecular marker-assisted selection breeding.

[0013] The primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 in the sequence list is used in the directional breeding or auxiliary directional breeding of soybean lines with high nodulation number.

[0014] The invention discloses a method for identifying or assisting in identifying the number of soybean nodules in the early stage of breeding. The method comprises the following steps: based on the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, in the early stage of molecular marker-assisted selection breeding, using the genomic DNA of the soybean to be tested as a template, and using the primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to perform fluorescence quantitative PCR amplification, and performing genotyping according to the fluorescence detection result of the obtained amplified product. If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-FAM, and exhibits yellow fluorescence, the soybean sample to be tested is a soybean variety with a large number of nodules; if the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-VIC, and exhibits blue fluorescence, the soybean sample to be tested is a soybean variety with a small number of nodules.

[0015] Based on the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, a molecular marker related to the number of soybean nodules was developed.

[0016] According to the SNP site corresponding to the 20th base of the sequence shown in SEQ ID NO.1, a molecular marker related to the number of soybean nodules was developed, and the molecular marker was a KASP molecular marker.

[0017] The beneficial effect produced by adopting the above technical scheme is that the research of the present invention collects, plants and sequences the early-maturing and very early-maturing soybean varieties suitable for planting in the Bashang Plateau area of ​​northern Hebei Province, and locates a site on chromosome 2 that is significantly associated with the number of soybean nodules in combination with a high-density genetic linkage map, and performs linkage disequilibrium analysis on the SNPs in its ±100kb region, and develops a molecular marker Chr02_43129492_T_C that is closely linked to the nodule quantity trait, which can accurately divide the participating soybean population into high nodule number (T / T) and low nodule number (C / C). Therefore, the molecular marker can be used as the basis for preliminary identification of the number of soybean nodules, and has high efficiency and applicability such as simple operation, low cost and short time consumption, and is of great value for digging the germplasm of high-nodulation soybeans, solving the abuse of nitrogen fertilizers, and promoting the sustainable development of agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the normal distribution diagram of BLUE analysis of the tested soybeans in Example 3;

[0019] Figure 2 The Manhattan plot and QQ plot of the number of nodules of the tested soybeans in Example 3;

[0020] Figure 3 This is a schematic diagram of the genotyping results of the tested soybeans using the KASP marker in Example 4;

[0021] Figure 4 The figure is a bar chart showing the number of nodules and the corresponding genotype statistics of the tested soybeans in Example 4. DETAILED DESCRIPTION

[0022] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The materials, reagents, etc. used in the following examples. Unless otherwise specified, they can be obtained from commercial sources. It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0023] As used in the specification of the present application and the appended claims, the term "if" can be interpreted as "when..." or "once" or "in response to determination" or "in response to detection" according to the context. Similarly, the phrase "if it is determined" or "if [the described condition or event] is detected" can be interpreted as meaning "once it is determined" or "in response to determination" or "once [the described condition or event] is detected" or "in response to detection [the described condition or event]" according to the context. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the sentences "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in the specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof all mean "including but not limited to", unless specifically emphasized otherwise.

[0024] Example 1, plant material

[0025] The present invention collects, evaluates and identifies 260 representative early-maturing and very early-maturing soybean varieties from Northeast China suitable for planting in the Bashang Plateau area in northern Hebei, constituting a micro-core germplasm resource (see Table 1), which is sown at the Guyuan Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (41°66′N, 115°68′E).

[0026] Table 1 Numbers and names of 260 soybean germplasm resources

[0027]

[0028]

[0029]

[0030]

[0031] Example 2, Experimental Design

[0032] Using the outdoor artificial inoculation identification method, the rhizobium strain USDA110 was inoculated into fresh TY liquid medium (each 500 μL of rhizobium was inoculated into 200 mL of TY medium) and cultured in a shaker at 160 rpm at 28°C for 3-4 days until the bacterial solution concentration reached OD600 =0.8-1.0, 2mL of bacterial solution was injected on the surface of each seed, and then a thin layer of vermiculite was covered on the surface; B&D nitrogen-free nutrient solution and tap water were used for alternating irrigation, 2L each time. The number of effective nodules was counted 21 days after the true leaves grew out, and the nodule number (NN) of soybean plants was counted with nodules ≥2mm as the evaluation standard of effective nodules. The test soybean materials were set up for three biological replicates in the same environment. In each biological replicate, one test material was planted in three pots, and three seedlings were set in each pot.

[0033] Example 3. Genotype data and genome-wide association analysis

[0034] The variance, correlation and skewness of the number of nodules of the tested soybean were analyzed using the corresponding programs in SPSS Statistics V27.0 software, and the heritability analysis was performed using QTL lciMapping V4.1. The results are shown in Table 2. The best linear unbiased estimates (BLUE) of the number of nodules were performed using RV4.3.3 software. The normal distribution diagram is shown in Figure 1 .

[0035] Table 2 Statistical analysis of phenotypic variation in nodule number of superior soybean germplasm inoculated with USDA110 in Bashang, northern Hebei

[0036]

[0037] The heritability was 0.75, indicating that the quantitative traits of soybean nodulation in the 260 tested samples were mainly affected by genetic factors and less affected by environmental factors. The DNA of the leaf tissues of the 260 soybean materials collected was extracted and resequencing was performed. With reference to the SoySNP50K chip site (SONG QJ, HYTEN DL, JIA GF, QUIGLEY CV, FICKUS EW, NELSON RL, CREGAN P B. Development and evaluation of SoySNP50K, a high-density genotyping array for soybean. PLoS ONE, 2013, 8 (1): e54985.), the resequencing data was extracted, and a total of 42499 SNP markers were obtained. After excluding SNP markers with minor allele frequency (MAF) ≤ 5%, a total of 30799 SNP markers were used for genome-wide association analysis. The mixed linear model (MLM) in the R software package “rMVP” (YINLL, ZHANG HH, TANG ZS, XU JY, YIN D, ZHANG ZW, YUAN XH, ZHU MJ, ZHAO SH, LIU XL. rMVP: A memory-efficient, visualization-enhanced, and parallel-accelerated tool for genome-wide association study. Genomics, Proteomics & Bioinformatics, 2021, 19(4): 619-628.) was used to perform genome-wide association analysis on the number of nodules, and Manhattan plots and QQ plots were drawn (see Figure 2 ). LOD ≥ 3.0 was set as the significance threshold of association analysis, and it was found that there was a relatively continuous interval site with LOD ≥ 3 in the physical position Chr.02: 43119820-43230817 of the tested soybean. The ANOVA function of RV4.3.3 was used for variance analysis, and P < 0.05 was used as the significance level to judge the significance of phenotypic differences between different haplotype materials.

[0038] Example 4. Development and application of KASP molecular markers

[0039] For the sites significantly associated with the number of nodules between Chr.02:43119820-43230817, a total of 3 sites Chr02_43127791_A_G, Chr02_43129492_T_C, and Chr02_43119820_T_C were selected. Based on the KASP principle, KASP molecular markers were developed according to their base sequences. A total of 8 pairs of PCR amplification primers were designed. Among them, it was found that at Chr02_43129492, the varieties with high nodule numbers (genotype T / T) and low nodule numbers (genotype C / C) could be clearly distinguished according to the fluorescence signal, showing yellow fluorescence, and the varieties with low nodule numbers (genotype C / C) showing blue fluorescence. The results of the detection of the other 7 pairs of primer combinations showed that the tested soybean materials all showed the same fluorescent group, and the genotyping results were inconsistent with the sequencing results. The molecular markers developed in the present invention are specifically designed as follows (the primer sequences are synthesized by Shanghai Sangon Biotechnology Co., Ltd.):

[0040] 2T-FAM: GAAGGTGACCAAGTTCATGCTAGCCACAACCATTTATTATT (SEQ ID NO. 2);

[0041] 2T-VIC: GAAGGTCGGAGTCAACGGATTAGCCACAACCATTTATTATC (SEQ ID NO. 3);

[0042] 2T-R: GAGGAACTGAATCATCAAGCTTAC (SEQ ID NO. 4);

[0043] According to the use of this marker, the above-extracted DNA was used as a template to perform fluorescence quantitative PCR detection and analysis on the tested soybean germplasm. The system is shown in Table 3, wherein KASPAssay Mix was prepared by itself (2T-FAM, 2T-VIC 1.2 μL each, 2T-R 3 μL, ddH2O 4.6 μL), and the reaction program was: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, 10 cycles, with a decrease of 0.6°C in each cycle; 94°C for 20 s, 55°C for 1 min, 26 cycles, and finally 30°C for 1 min.

[0044] Table 3 PCR reaction system of the test population

[0045]

[0046] like Figure 3As shown, 100 soybean materials were amplified and genotyped using the marker: using the soybean genomic DNA to be tested as a template, a primer combination 2T-FAM, 2T-VIC and 2T-R consisting of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 was used to perform fluorescence quantitative PCR amplification, and genotyping was performed according to the fluorescence detection result of the obtained amplified product. If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-FAM, showing yellow fluorescence, the soybean sample to be tested is a soybean variety with a large number of nodules (genotype T / T); if the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer 2T-VIC, showing blue fluorescence, the soybean sample to be tested is a soybean variety with a small number of nodules (genotype C / C). The population was divided into two genotypes, T / T and C / C. There were 33 soybean materials with genotype T / T and 67 soybean materials with genotype C / C. The mean number of nodules of genotype T / T (11.822 / plant) was significantly greater than that of genotype C / C (7.928 / plant) (P<0.001), as shown in Table 4 and Figure 4 shown.

[0047] Table 4 Statistics of root nodules and corresponding genotypes of tested soybeans

[0048]

[0049]

[0050]

[0051] The results showed that the marker could effectively distinguish two homozygous genotypes and had a co-dominant characteristic; the marker could be used to assist in screening soybean progeny materials with high or low nodulation numbers.

[0052] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0053] From the above embodiments, it can be seen that the research of the present invention collects, plants and sequences the early-maturing and very early-maturing soybean germplasm resources suitable for planting in the northern Hebei plateau area from the northeast region, combines the high-density genetic linkage map, locates a site on chromosome 2 that is significantly associated with the number of soybean nodules, and conducts linkage disequilibrium analysis on the SNP in its ±100kb region, and develops a molecular marker Chr02_43129492_T_C that is closely linked to the nodule quantity trait, which can accurately divide the participating soybean population into high nodule number (T / T) and low nodule number (C / C). Therefore, this molecular marker can be used as the basis for preliminary identification of the number of soybean nodules, has high efficiency and applicability such as simple operation, low cost and short time consumption, and is of great value for digging the germplasm of high-nodulation soybeans, solving the abuse of nitrogen fertilizers, and promoting the sustainable development of agriculture.

[0054] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with soybean nodulation number, characterized by: The SNP site is located on soybean chromosome 2, and the physical distance of the SNP site in the soybean genome version number Glycine max Wm82.a2.v1 is Chr02_43129492. The SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.

1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the size of the nodule number is: the soybean homozygous for genotype A is greater than or has the potential to be greater than the soybean homozygous for genotype B.

2. A reagent or kit for identifying or assisting in identifying the quantitative trait of soybean nodulation, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1, and the reagent or kit comprises a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

3. The reagent or kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: a primer combination consisting of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, 2T-FAM, 2T-VIC and 2T-R.

4. A primer combination, characterized in that: Used to detect the single nucleotide polymorphism of the following SNP site in the soybean genome, the SNP site is located on soybean chromosome 2, the physical distance of the SNP site in the soybean genome version number Glycinemax Wm82.a2.v1 is Chr02_43129492, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the size of the nodule number is: the soybean homozygous for genotype A is greater than or is a candidate to be greater than the soybean homozygous for genotype B; the primer combination is the primer pair 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 in the sequence list; this primer combination is used to detect the SNP site described in claim 1.

5. Use of the SNP locus according to claim 1 in soybean molecular marker-assisted selection breeding.

6. Use of the SNP loci described in claim 1 in the initial screening, and / or rescreening, and / or identification, and / or classification, and / or auxiliary identification of soybean nodule number in the early stage of soybean molecular marker-assisted selection breeding.

7. Use of the primer combination according to claim 4 in directed breeding or assisted directed breeding of soybean lines with high nodulation numbers.

8. A method for identifying or assisting in identifying the number of soybean nodules in the early stage of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, the soybean genomic DNA to be tested is used as a template, and the primer combination 2T-FAM, 2T-VIC and 2T-R composed of SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 is used to perform fluorescence quantitative PCR amplification, and genotyping is performed according to the fluorescence detection result of the obtained amplified product. If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with primer 2T-FAM, and exhibits yellow fluorescence, the soybean sample to be tested is a soybean variety with a large number of nodules; if the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with primer 2T-VIC, and exhibits blue fluorescence, the soybean sample to be tested is a soybean variety with a small number of nodules.

9. Using the SNP locus according to claim 1, developing a molecular marker associated with the number of soybean nodules.

10. The molecular marker according to claim 9, which is a KASP molecular marker.

Images