Taq DNA polymerase mutant and application thereof

A polymerase and mutant technology, applied in the biological field, can solve problems such as poor amplification of the target region, poor results in one degree and yield, and insufficient sensitivity of reagents, so as to improve sensitivity and compatibility, and library uniformity. Once good, the effects of increased sensitivity and yield

Inactive Publication Date: 2019-03-01
VAZYME BIOTECH NANJING
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Existing amplification reagents are not effective in terms of product uniformity and yield, which is manifested in samples with poor quality, such as formalin-fixed paraffin-embedded (FFPE) samples, cell-free DNA (cfDNA), etc., and When the sample input amount is low (less than 0.1ng), the sensitivity of the reagent is not enough, and the target area cannot be well amplified
Existing amplification reagents have poor compatibility when amplifying different TM value systems, and these defects have a great impact on subsequent sequencing library construction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taq DNA polymerase mutant and application thereof
  • Taq DNA polymerase mutant and application thereof
  • Taq DNA polymerase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Use 2× of Nanjing Nuoweizan Biotechnology Co., Ltd. Max Master Mix (P515) and Ultra One Step Cloning Kit (C115) performs site-directed mutation on Taq DNA polymerase (sequence shown in SEQID NO.1), and the primers used for point mutation are as follows to obtain a mutant, called Taq-Mut, whose mutation site The points are: K53N, G364D, R636H (the sequence is shown in SEQ ID NO.2), the nucleic acid sequence before mutation is shown in SEQ ID NO.3, and the nucleic acid sequence after mutation is shown in SEQ ID NO.4.

[0037] The primer sequences (5'-3') used for point mutations are as follows:

[0038] AB-1F: GGTATATCTCTTCTTAAAGATGAGGGGGATGCTGCCC

[0039] AB-1R: TCCTTGAGGGCGTTGAGGAGGCTCTTGGCGAAGC

[0040] BC-1F:CTCCTCAACGCCCTCAAGGAG

[0041] BC-1R: AGGCCAAGGTCTTCCCTCAGGGCCAGAACG

[0042] CD-1F: CTGAGGGAAGACCTTGGCCTC

[0043] CD-1R: CGTGTGGATGTCGTGCCCCTCCTGGAAG

[0044] DE-1F: AGGGGCACGACATCCACACGGAGACCGCCAGCTGGATGT

[0045] DE-1R: GATAACAATTCCCCTCTAGATCCTTGGCGG...

Embodiment 2

[0050] Example 2 Application of Taq-Mut in Amplicon Library Construction

[0051] Use Taq-Mut to prepare the following different reaction systems for PCR:

[0052] Multiplex amplification reaction system 1: Taq-Mut 2U, Tris 25mM, KCl 20mM, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;

[0053] Multiplex amplification reaction system 2: Taq-Mut 2U, Tris 25mM, KCl 20mM, DMSO 2%, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;

[0054] Multiplex amplification reaction system 3: Taq-Mut 2U, Tris 25mM, KCl 50mM, DMSO 2%, MgCl 2 1mM, dNTP 0.2mM, primer 10nM each, DNA input 1ng, pH7.6;

[0055] The above three systems were subjected to multiple amplification, and the input amount of 293T cell nucleic acid DNA was 1ng. The reaction procedure was as follows: 99°C for 2min; (99°C for 15sec; 60°C for 4min); 22 cycles; 72°C for 10min; 4°C hold. Run nucleic acid electrophoresis on a 3% agarose gel to obtain figure 2 The results shown, system 1 is...

Embodiment 3

[0057] The reagents required to prepare for multiplex amplification include the amplification reagent Multi-PCR Mix, which is 2× concentration, and the concentration of key components is: Taq-Mut 4U, Tris 50mM, KCl 100mM, DMSO 4%, MgCl 2 2mM, dNTP0.4mM, pH7.6. Combined with the Adapters and Ligation Enzyme Mix required for conventional ligation, 207 primer pairs (Nanjing Nuoweizan Biotechnology Co., Ltd., VAHTS AmpSeqCancer HotSpot Panel NA102) for amplifying hot spot mutation regions of human tumor-related genes were used. The samples were human FFPE samples and One human cfDNA sample, after extracting DNA in a conventional way, the reaction system (1×concentration): Taq-Mut 2U, Tris 25mM, KCl 50mM, MgCl 2 1mM, DMSO2%, dNTP 0.2mM, primer 10nM each, pH7.6, FFPE DNA input amount 10ng / cfDNA input amount 1ng, primer digestion, adapter ligation, purification, library amplification, library purification, and amplicon library WK1, WK2, the amplicon libraries WK3 and WK4 obtained...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Taq DNA polymerase mutant and application thereof. The Taq DNA polymerase mutant is an amino acid sequence formed by insertion, substitution or depletion of one or more aminoacids in an amino acid sequence of Taq DNA polymerase shown as SEQ ID NO. 1, or by addition or deletion of one or more amino acids in the sequence of SEQ ID NO. 1. Compared with Taq DNA polymerase shown as SEQ ID NO. 1, the amino acid sequence has enhanced amplification sensitivity and increased yield. The Taq DNA polymerase mutant has higher sensitivity and yield than original Taq DNA polymeraseand is also suitable for multiple amplification of low-quality samples.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a Taq DNA polymerase mutant and application thereof. Background technique [0002] At present, high-throughput sequencing technology has been widely used due to its lower price, more comprehensive and in-depth analysis of the whole genome, and is of great significance in scientific research, disease diagnosis and treatment. In many practical applications, the entire genome does not need to be sequenced, but only specific genomic regions need to be analyzed. Targeted sequencing technology is a high-throughput sequencing technology for specific library construction and sequencing of specific target sites in the genome. At present, targeted sequencing can be achieved in two ways, one is targeted probe capture sequencing, and the other is amplicon sequencing. Amplicon sequencing is to design primers for the genomic region of interest, perform PCR amplification, enrich the target region...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/63
CPCC12N9/1252C12N15/63C12Y207/07007
Inventor韩锦雄聂俊伟曹林张力军瞿志鹏江明扬宝华宾
OwnerVAZYME BIOTECH NANJING