Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mixed type hot-start DNA polymerase composition, PCR amplification kit, and applications thereof

A polymerase and hot-start technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the difficult amplification of target DNA, the mismatch rate needs to be further reduced, and does not meet higher sensitivity and accuracy, etc. question

Active Publication Date: 2018-09-18
深圳市艾伟迪生物科技有限公司
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For experiments that require very strict mismatch rates, such as gene screening, sequencing, mutation detection, etc., ordinary DNA polymerases are far from meeting the requirements
Although the newly released KOD DNA polymerase can reduce the mismatch rate to a certain extent, the mismatch rate still needs to be further reduced, and the polymerization ability of KOD DNA polymerase is generally poor, and it is difficult to amplify longer fragments of target DNA come out
In addition, traditional DNA polymerases have poor amplification effect on amplified templates with a template amount of less than 1 pg and amplified templates with high GC content, which does not meet the detection requirements of higher sensitivity and accuracy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mixed type hot-start DNA polymerase composition, PCR amplification kit, and applications thereof
  • Mixed type hot-start DNA polymerase composition, PCR amplification kit, and applications thereof
  • Mixed type hot-start DNA polymerase composition, PCR amplification kit, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Embodiment 1 prepares mutant type KOD DNA polymerase

[0075] Design the target gene expression sequence according to the amino acid sequence shown in SEQ ID No.1, and entrust a gene synthesis company to synthesize it. In this example, Suzhou Hongxun Co., Ltd. was entrusted to synthesize and verify by sequencing that the gene expression fragments with mutations at specific sites were obtained. The expression sequence of the target gene was transformed into BL21(DE3) according to the method recommended by the kit for induced expression and purification, and the target protein with a purity of more than 90% was obtained, and the protein size was about 90KD. The purification process and the SDS-PAGE pictures of each protein sample after purification are as follows: figure 1 As shown, the marked "sample" on the figure indicates the electrophoresis lane of the protein sample collected after induction, "flow through" indicates the sample flowing through the purification colu...

Embodiment 2

[0080] Application of embodiment 2PCR amplification kit

[0081] Taking 25 μL as an example, configure the solution for the PCR amplification system as described in Table 1 below.

[0082] Table 1: Recommended PCR amplification system

[0083]

[0084] In the present invention, it is recommended to use the 2×PCR Enhancer (PCR enhancer) included in the kit, which is beneficial to the amplification of trace template DNA. If the GC content of the template exceeds 50%, it is recommended to use GC buffer for amplification.

[0085] The recommended PCR reaction conditions are shown in Table 2 below:

[0086] Table 2: PCR reaction conditions

[0087]

[0088] Note: Choose an appropriate number of cycles and an appropriate annealing temperature to avoid specific amplified bands.

Embodiment 3

[0089] Embodiment 3 detects different PCR reaction conditions

[0090] Using a 2.9Kb DNA fragment (PET-28a) as a template, design the following amplification primers,

[0091] Amplification primers for 2.9Kb fragment:

[0092] PET-28a-F:ATCCGGATATAGTTCCTCCT (as shown in SEQ ID No.3)

[0093] PET-28a-R:CAGTATACACTCCGCTATGC (as shown in SEQ ID No.4)

[0094] In the case of unifying all other reaction conditions, gradient change of MgCl in PCR buffer 2 Concentration (0mmol / L~5mmol / L), (NH 4 ) 2 SO 4 The concentration of KCl (15mmol / L~65mmol / L), the concentration of KCl (5mmol / L~55mmol / L), and its pH value (6.8~8.8), carry out multiple sets of PCR reactions, and use the agarose electrophoresis graph of PCR products to To characterize the catalytic activity of KTaq MIX DNA Polymerase (mixed type hot-start DNA polymerase composition) in PCR reaction. Among them, the brighter the bands of the PCR products, the higher the efficiency of the PCR reaction of this group, that is, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mixed type hot-start DNA polymerase composition, a PCR amplification kit, and applications thereof. The composition comprises Taq DNA polymerase, an anti-Taq antibody, and mutant type KOD DNA polymerase. The anti-Taq antibody is capable of specifically being combined with Taq DNA polymerase. The 147th site of wild type KOD DNA polymerase is histidine, and the 147th site of mutant type KOD DNA polymerase is lysine. The experiment results show that the mismatch rate is low when the mixed type hot-start DNA polymerase composition is used for PCR amplification, the composition has the dual characteristics of high efficient amplification and high fidelity and is heat resistant in amplification, and the amplification effect is good no matter for a long DNA segment, a template with a low amount, or a template with a high GC content.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a mixed hot-start DNA polymerase composition, a PCR amplification kit and applications thereof. Background technique [0002] PCR amplification (polymerase chain reaction) is a molecular biology technique used to amplify and amplify specific DNA fragments, which can be regarded as special DNA replication outside the body. The principle is to use DNA denaturation at a high temperature of 95°C in vitro to become a single strand, and at a low temperature (often around 60°C), the primer and the single strand are combined according to the principle of base complementary pairing. Then adjust the temperature to the optimum reaction temperature of DNA polymerase (about 72°C), and DNA polymerase synthesizes complementary chain along the direction from phosphoric acid to five-carbon sugar (5'-3'). [0003] DNA polymerase is an enzyme that plays a key role in replicating DNA. DN...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/686
CPCC12Q1/686
Inventor 周娇娇李泓彦莫颜瑛张敏
Owner 深圳市艾伟迪生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com