Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion type Taq DNA polymerase as well as preparation method and application thereof

A polymerase and fusion technology, applied in the biological field, can solve problems such as affecting the detection rate and detection limit of trace templates, reducing sensitivity and amplification efficiency, and ineffective amplification, achieving good amplification performance and improving amplification. The effect of increasing speed and impurity tolerance

Active Publication Date: 2020-09-22
VAZYME BIOTECH NANJING
View PDF17 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In literature reports and practical applications, the main problem of one-step RT-qPCR is that reverse transcriptase has a strong inhibitory effect on DNA polymerase, which reduces the sensitivity and amplification efficiency, especially when the amount of template is low, it is easy to appear The phenomenon of sloping line and unable to amplify the line seriously affects the detection rate and detection limit of trace templates
At present, researchers do not have a clear understanding of the cause and molecular mechanism of this phenomenon. They mainly alleviate it by adjusting the ratio of the two enzymes and the composition of the buffer system, but they cannot fundamentally solve this problem.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion type Taq DNA polymerase as well as preparation method and application thereof
  • Fusion type Taq DNA polymerase as well as preparation method and application thereof
  • Fusion type Taq DNA polymerase as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] The preparation of embodiment 1 fusion type Taq DNA polymerase

[0064] The nucleic acid sequence shown in SEQ ID NO:5 is loaded into pET28, purified by a histidine tag (His-Tag), and an expression vector of fusion-type Taq DNA polymerase is constructed; the successfully constructed expression vector is transferred into a host cell, Culture in liquid medium, when OD600 = 0.4-0.6, add IPTG with a final concentration of 1 mM, and induce expression overnight at 16° C. and 180 rpm. The bacteria were collected, subjected to column purification after ultrasonic disruption, and the steps were as follows:

[0065] (1) Using a low-pressure chromatography system, the supernatant was loaded onto a Ni-IDA Binding-Buffer pre-equilibrated Ni-IDA-Sepharose Cl-6B affinity chromatography column at a flow rate of 0.5 mL / min (Sangon Biotech Engineering (Shanghai) Co., Ltd.);

[0066] (2) Use Ni-IDA Binding-Buffer to wash the chromatography column at a flow rate of 0.5mL / min until the OD...

Embodiment 2

[0072] In this example, λDNA is used as a template, and human whole blood is used as an impurity to put into the λDNA template, and the input amounts are 0%, 5%, 10% and 15%, respectively, and PCR amplification is carried out by using fusion-type DNA polymerase (Taq-M2) , primers are as shown in SEQ ID NO:6~7, the amplification system is as shown in Table 1, and a wild-type Taq DNA polymerase (Taq) control group is set, and the amplification system of the control group is as shown in Table 2;

[0073] Lambda DNA upstream primer (SEQ ID NO: 6): AGCAGTGCAGCGAACTGAGC;

[0074] Lambda DNA downstream primer (SEQ ID NO: 7): AAGCGCAGACGGTCGATGT.

[0075] Table 1 Fusion DNA polymerase (Taq-M2) amplification system

[0076]

[0077]

[0078] Table 2 wild-type Taq DNA polymerase (Taq) amplification system

[0079] Element Amount added (μL) Champagne Taq DNA polymerase (5U / μL) 1 10×Champagne Taq Buffer (Mg 2+ plus)

2 λDNA upstream primer (10μM) 0...

Embodiment 3

[0085] In this embodiment, the porcine diarrhea coronavirus (PEDV) vaccine is used as a sample, and the viral nucleic acid rapid extraction kit (product number R312-01) is used to extract viral RNA, and the steps are as follows:

[0086] (1) Add 200 μL of absolute ethanol to a 1.5 mL RNase-free centrifuge tube, and pre-pack multiple samples;

[0087] (2) Add 200 μL sample and vortex to mix;

[0088] (3) Put the adsorption column in a 2mL collection tube, add the above mixed solution to the adsorption column, and centrifuge at 12000g for 1min;

[0089] (4) Discard the filtrate, put the adsorption column back into the 2mL collection tube, add 600 μL of rinsing solution (add absolute ethanol in advance), centrifuge at 12000 g for 30 sec, and discard the filtrate;

[0090] (5) Repeat step (4) once;

[0091] (6) Put the adsorption column back into the collection tube, and centrifuge the empty column at 12000g for 2min;

[0092] (7) Transfer the adsorption column to a new 1.5mL c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides fusion type Taq DNA polymerase as well as a preparation method and application thereof. The fusion type Taq DNA polymerase comprises a Taq DNA polymerase mutant and DNA bindingprotein, wherein the Taq DNA polymerase mutant is protein obtained by carrying out substitution mutation on one or more sites of a helix-hairpin-helix DNA binding region of wild type Taq DNA polymerase. The fusion type Taq DNA polymerase has enhanced nucleic acid binding capacity, amplification speed and impurity tolerance, has good resistance to inhibition of reverse transcriptase, and has good amplification performance for trace templates, and a biological sample can be directly detected without a nucleic acid extraction step; and a constructed one-step RT-qPCR kit is high in detection speed, high in sensitivity and good in accuracy, and has a wide application prospect in the field of RNA virus detection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a fusion type Taq DNA polymerase and its preparation method and application. Background technique [0002] At present, the detection methods of RNA viruses mainly include immunoassay and nucleic acid detection, among which RT-qPCR is the most widely used for nucleic acid detection, which has the characteristics of fast detection speed and high accuracy. RT-qPCR is reverse transcription real-time fluorescent quantitative PCR. Firstly, the RNA template is reverse-transcribed into cDNA, and then PCR is used for quantitative detection. RT-qPCR includes fluorescent dye method and fluorescent probe method: fluorescent dye method uses fluorescent dye to bind to the minor groove of double-stranded DNA to indicate the increase of amplified product; Taqman fluorescent probe is a specific oligonucleotide, two Each end is labeled with a fluorophore and a quencher. When the probe is intact, the f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C12N15/54C12Q1/70C12Q1/686
CPCC12N9/1252C12Q1/686C12Q1/701C12Y207/07007C12Q2521/107C12Q2563/107C12Q2521/101Y02A50/30
Inventor 曹林聂俊伟瞿志鹏张力军吴恒韩锦雄江明扬
Owner VAZYME BIOTECH NANJING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More