Taq DNA polymerase mutant and application thereof

A polymerase, mutant technology, applied in the biological field

Active Publication Date: 2020-02-04
VAZYME BIOTECH NANJING
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, a long time of research is to carry out gene mutations in the first domain and the second domain, and screen the mutants that can improve the tolerance of whole blood. There are almost no mutations about the third domain, which is of great importance to the research of the third domain. significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taq DNA polymerase mutant and application thereof
  • Taq DNA polymerase mutant and application thereof
  • Taq DNA polymerase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 The acquisition of four kinds of mutants

[0032] According to the conventional method, use Nanjing Nuoweizan Biotechnology Co., Ltd. Max Master Mix (P515) and Ultra One Step Cloning Kit (C115) performs site-directed mutation on Taq DNA polymerase (sequence shown in SEQID NO.1) to obtain mutants, which are named: Mut1, Mut2, Mut3 and Mut4.

[0033] The mutation sites of Mut1 are: T386A, A407L, F413Y (sequence shown in SEQ ID NO.2);

[0034] The mutation sites of Mut2 are: T386A, A407L (sequence shown in SEQ ID NO.3);

[0035] The mutation sites of Mut3 are: A407L, F413Y (sequence shown in SEQ ID NO.4);

[0036] The mutation sites of Mut4 are: T386A, F413Y (sequence shown in SEQ ID NO.5).

[0037] The primers used for Mut1 point mutation are shown in Table 1-2 below:

[0038] Table 1 Mut1 primer sequence

[0039] Primer name 5'-3' sequence 1-1F CCAACACCGCCCCCGAGGGGGTG 1-1R TCGGGGGCGGTGTTGGAAGGGTCCAG 2-1F GCCCTCCTTTCCGAGAG...

Embodiment 2 4

[0062] Example 2 Four kinds of mutant Taq have higher blood tolerance

[0063] The wild-type Taq and the four mutants were prepared into 2×PCR Mix according to the following formula, and five kinds of 2×PCR Mix were obtained.

[0064] 2×PCR Mix1: 200mM Tris-HCl, 100mM KCl, 0.8mM dNTP, 4mM MgCl 2 , 0.2U / μl Taq;

[0065] 2×PCR Mix2: 200mM Tris-HCl, 100mM KCl, 0.8mM dNTP, 4mM MgCl 2 , 0.2U / μl Mut1;

[0066] 2×PCR Mix3: 200mM Tris-HCl, 100mM KCl, 0.8mM dNTP, 4mM MgCl 2 , 0.2U / μl Mut2;

[0067] 2×PCR Mix4: 200mM Tris-HCl, 100mM KCl, 0.8mM dNTP, 4mM MgCl 2 , 0.2U / μl Mut3;

[0068] 2×PCR Mix5: 200mM Tris-HCl, 100mM KCl, 0.8mM dNTP, 4mM MgCl 2 , 0.2 U / μl Mut4.

[0069] Five kinds of 2×PCR Mix were mixed according to the following table 20 (50 μl reaction system). In order to control the input amount of template in each well to be consistent, λDNA was used as template and blood was added as impurity to verify blood tolerance.

[0070] Table 9 Mixing method of PCR reaction syst...

Embodiment 3

[0080] Embodiment 3 detects the enzyme activity of four kinds of mutants and wild-type Taq

[0081] The five kinds of 2×PCR Mixes prepared in Example 2 were tested for enzyme activity by conventional methods in the art, and the results are shown in Table 12.

[0082] Table 12 Enzyme activity detection results of 5 kinds of 2×PCR Mix (enzyme activity, unit: mU / μl)

[0083] Enzyme type Repeat one repeat two repeat three average value 2×PCR Mix1 192 190 188 190 2×PCR Mix2 195 183 190 189 2×PCR Mix3 184 191 183 186 2×PCR Mix4 190 187 192 190 2×PCR Mix5 183 197 190 190

[0084] It can be seen from the data in Table 12 that the enzyme activity of the mutant enzyme is not enhanced, but it shows good amplification performance when amplifying blood samples. Therefore, in combination with the results of Example 2, we speculate that: T386A (threonine mutated into alanine), A407L (alanine mutated into leucine), F413Y (phe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Taq DNA polymerase mutant and application thereof. The Taq DNA polymerase mutant has amino acid substitutions at one or more of the following amino acid positions in the sequence shown as SEQ ID NO. 1; and the various amino acid substitutions are represented in triplets as 'letters-numbers-letters', wherein the numbers reflect position of an amino acid mutation, the letters before the numbers are corresponding to an amino acid involved in the mutation, and the letters after the numbers reflect an amino acids used to replace the amino acid corresponding to the lettersbefore the numbers. The Taq DNA polymerase mutant disclosed by the invention is capable of changing configuration of an enzyme, thereby improving tolerance of the enzyme; and thus, the mutant can be very well applied in blood sample amplification.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a Taq DNA polymerase mutant and application thereof. Background technique [0002] PCR technology has been widely used in many fields such as molecular diagnosis of genetic diseases, animal and plant import and export quarantine, clinical inspection, food safety monitoring, paternity testing and soil microbial detection. The detected gene templates mainly come from tissues, saliva, cells, sputum, blood, feces, and soil. Because there are hemoglobin, heme, lactoferrin, IgG and humic acid in samples such as blood and soil, these substances have a strong inhibitory effect on Taq DNA polymerase. The traditional method is to extract the nucleic acid from these samples and then perform PCR amplification. Due to the increasing detection throughput in this field, the traditional method has many steps, resulting in low work efficiency, time-consuming reagents, high time and financial costs,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/12C12N15/54C12Q1/686
CPCC12N9/1252C12Q1/686C12Y207/07007C12Q2521/101C12Q2565/125
Inventor瞿志鹏聂俊伟韩锦雄曹林张力军江明扬赵芳芳
OwnerVAZYME BIOTECH NANJING