228 results about "Siniperca chuatsi" patented technology

The invention relates to the technical field of aquaculture, and specifically relates to a feed for siniperca chuatsi. The feed is prepared by the following raw materials by weight: 55-60 parts of corn, 20-22 parts of rye bran, 10-12 parts of peanuts, 20-25 parts of rapeseed meal, 6-8 parts of chironomidae larvae powder, 8-10 parts of small carp meal, 8-10 parts of loach dry powder, 6-8 parts of herba houttuyniae, 10-12 parts of white fish meal, 6-8 parts of escargot powder, 8-10 parts of dry sphagna powder, 5-6 parts of meat and bone meal, 6-8 parts of radish leaves, 0.5-1 part of rheum officinale, 1-2 parts of saponin, 1-2 parts of felwort, a proper amount of salt and 4-5 parts of a phagostimulant. In consideration of the carnivorous characteristic of the siniperca chuatsi, an abundance of raw materials such as small carp meal, loach dry powder, white fish meal and escargot powder are added in the prepared feed for siniperca chuatsi, so that enough nutrients are provided for the growth and development of the siniperca chuatsi. Traditional Chinese medicine components such as herba houttuyniae, rheum officinale and saponin are added, so that disease-resistant capacity of the siniperca chuatsi can be enhanced. Particularly, parasitic diseases can be prevented; morbidity of the siniperca chuatsi is reduced; and loss of culture benefits can be prevented.

The invention discloses a method for ecologically culturing high-quality red testis river crabs, which fully utilizes natural conditions and resources of ponds, natural waters, rivers, reservoirs, lakes and wetlands, starts from biological, ecological and environmental mechanisms, follows the characteristics of respective econiches occupied by various organisms in biology, is based on biological characteristics of river crabs such as life habit, feeding habit, growth and development and the like, reasonably applies ecological balance breeding technology and nutrient balance technology, builds the best ecological environment of the culture of the river crabs, and meets the nutritional need of the growth and development of the river crabs to raise the high-quality 'red testis' river crabs. The ecological culture method comprises the following steps of: culture pond pretreatment, aquatic plant cultivation, shellfish transplantation, freshwater shrimp stocking, crab seedling stocking, siniperca chuatsi delivery, water quality control, bait feeding, and disease control. The method for culturing the river crabs can produce the high-quality and high-grade 'red testis' river crabs, can greatly improve the economic benefit of crab farmers, and can greatly improve the sustainable development of crab culture industry and the ecological benefit, the economic benefit and the social benefit of crab culture.

The invention discloses a method for large-scale breeding of large-standard mandarin fish fingerling. The method comprises the steps of 1 pool selection, 2 pool cleaning and disinfection, 3 forage fish breeding, 4 mandarin fish fry and large-scale fingerling breeding, 5 released density determination, 6 forage fish feeding, 7 water quality management and 8 disease control. The method is easy and convenient to operate, simple in device, easy to manage and high in fingerling survival rate. The method takes the lead in successfully breaking through a key of a large-scale mandarin fish fingerling technology at home and abroad, natural bait breeding through fertilizer controlled-release bags and manual bait domestication is used in cooperation for feeding are creatively and successfully achieved in the aspects of fingerling breeding, bait feeding and the like, the blank of domestic large-scale mandarin fish fingerling breeding in a pool is filled, the survival rate of the fingerling is over 80%, the water quality of the pool is kept good, most effective practical measures and means are created for thorough development of mandarin fish serving as a famous excellent breeding breed, and the method has the great social benefit and economic benefit.

The invention belongs to the technical field of special aquaculture, and particularly relates to a special taming feed for mandarin fish, and a mating taming method. The special taming feed for mandarin fish is prepared by mixing the following raw materials in parts by weight: 70 parts of White fish powder, 10 parts of shrimp meal, 5 parts of chicken intestine, 2 parts of a compound feed attractant, 5 parts of cod-liver oil, 1 parts of decavitamin, 2 parts of compound mineral substances and 5 parts of an adhesive, wherein the compound feed attractant is cuttlefish cream and inosinic acid. The invention further provides a progressive mandarin fish taming method. The mandarin fish can be entirely fed with the special feed through taming, the culturing cost and morbidity of mandarin fish can be reduced, and the sustainable development of the mandarin fish aquaculture industry can be realized.

The invention discloses a breeding method of hybrid mandarin fishes. The breeding method comprises the following steps of a, parent selection, b, artificial spawning and insemination, c, hatch management, d, fry rearing, and e, fry taming feed. According to the method, siniperca scherzeri and siniperca chuatsi which are bred through multiple generations are used as hybrid parents, the hybrid mode of siniperca scherzeri (o+)*siniperca chuatsi (o) is adopted, and new-type mandarin fishes are generated. The hybrid mandarin fishes of the new type are developed for the high-range fresh water aquaculture industry, are superior to siniperca chuatsi in meat taste and disease resistance, higher than siniperca scherzeri in growth speed, capable of eating non-live fishes, good in economic trait, and convenient to culture in large scale through manpower.

The invention discloses an enclosure intercultural mode and an aquaculture method thereof. River crabs in a lake enclosure serve as the main aquaculture variety, and meanwhile, tropical fresh water Macrobrachium rosenbergii, Macrobrachium nipponensis, Odontobutis obscurus and Siniperca chuatsi are intercultured, wherein the Macrobrachium nipponensis, the Odontobutis obscurus and the Siniperca chuatsi are commonly seen in lakes. According to the intercultural mode, feedstuff can be fully utilized, pollution caused by river crab aquaculture is reduced, aquaculture benefits are improved, and the intercultural mode is environmentally friendly and efficient.

The invention relates to an ecological aquaculture method of high quality Chinese mitten crabs and belongs to the technical field of aquaculture. The method comprises the steps that a pond is selected, cleaned, prepared and sterilized; from February to March in early spring, aquatic plants are planted, a '2+2' composite aquatic plant planting mode is adopted for aquatic plant planting, waterweed and potamogeton maackianus are used as main plants, and wild celery and hydrilla varticillata are used as auxiliary plants; young crabs are put; when the water temperature of the pond reaches above 10DEG C, feed starts to be put; from May to June, siniperca chuatsi and incubation freshwater shrimps are put into the pond; before the Qingming festival, snails start to be put into the pond; during daily management, the change of the water quality is observed, the water quality is adjusted, facilities are overhauled, and pests are removed in good time. According to the method, the aquaculture yield and specification of adult crabs are decided through the reasonable aquaculture density and breeding specification. 800 crabs are bred per mu, about 600 adult crabs are harvested per mu, the large-scale and high-quality brand crabs are bred through a '863' mode with output value of 30,000 yuan pre mu, and the method is an ecological aquaculture mode worthy of copying and popularization.

The invention discloses a fish steamed stuffed bun and a preparation method thereof. The fish steamed stuffed bun is mainly prepared by mixing raw materials including flour, mandarin fish, streaky pork, pigskin jelly, agaric, mushroom, celery, chopped green onion, bruised ginger, white sugar, yellow wine, potato starch, sesame oil, aromatic vinegar, soy sauce, refined salt, pepper powder and gourmet powder according to certain parts by weight. The fish steamed stuffed bun disclosed by the invention is unique in stuffing prescription, delicate and delicious in meat quality due to the mandarin fish, unique in taste since the mandarin fish is added into the stuffing of the fish steamed stuffed bun, and abundant in nutrition since protein, fat, vitamin and cellulose are reasonably matched with one another, thereby being a good healthy food edible for the man, the woman, the old and the young.

The invention discloses a molecular identification method used for siniperca chuatsi, siniperca scherzeri and a hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri comprises the following steps: 1) extracting a genome DNA of a to-be-detected mandarin fish (the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) sample; 2) with the extracted genome DNA of the to-be-detected sample as a template, amplifying a DNA target fragment by adopting polymerase chain reaction (PCR), wherein a pair of microsatellite primer sequences used in the PCR are as follows: a forward primer sequence, namely 5'ATGTAACCGTAAGTGACCTC3', and a reverse primer sequence, namely 5'TGTTGTTCAGACGATGACGA3'; 3) carrying out electrophoretic separation on the PCR product by adopting 8% non-denatured polyacrylamide gel, then carrying out silver staining, and photographing to record an electrophoresis result; and 4) comparing with a map of a standard digestion fragment, reading out the position of a target stripe of the to-be-detected mandarin fish sample, and respectively identifying the to-be-detected mandarin fish sample to be the siniperca chuatsi, the siniperca scherzeri or the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri. The molecular identification method used for the siniperca chuatsi, the siniperca scherzeri and the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri is easy and simple to operate, the defects of morphological identification are made up, and the problems that a hybrid mandarin fish (the hybrid f1 of the siniperca chuatsi and the siniperca scherzeri) is difficult to identify and varieties are miscellaneous during aquaculture are solved.

The invention discloses a manufacturing method and applications of an otolith cross section grinding sheet of a mandarin fish and belongs to the field of fish ecology. According to the manufacturing method, a sagitta serves as a research material, a cross section of the sagitta is subjected to sheet grinding, the manufactured otolith grinding sheet is placed under a microscope, the age can be identified and widths between rings can be measured through charge coupled device (CCD) software under the irradiation of incident light, ring distribution features of the otolith grinding sheet are observed, and then the age of the mandarin fish is identified. Compared with traditional identification methods, the method has the advantages that rings of the otolith of the mandarin fish are clear and visible, and an otolith nucleus is inclined towards one side of the otolith grinding sheet to form a linear nucleus area; a band area in which bright bands and dark bands are staggered is formed on the other side of the otolith starting from the otolith nucleus, bright bands are wide and are formed from spring to autumn, and dark bands are narrow and are formed in winter, so that annual rings are formed. By the aid of rings with alternating bright bands and dark bands, the age is distinguished and judged easily, so that the accuracy of identification of the age of the mandarin fish is greatly improved.

The invention discloses a crushing, screening and mixing integrated device for siniperca chuatsi aquatic feed processing. The crushing, screening and mixing integrated device for siniperca chuatsi aquatic feed processing comprises a stirring barrel and a crushing box, wherein a feeding hopper is embedded above the crushing box, and a crushing blade is arranged in the crushing box; a driving gear is arranged at one end of the crushing box; the outer side of the driving gear is rotatably connected to a reducer; a crushing motor is arranged on the outer side of the reducer; a fixed plate is fixedly connected above the crushing motor; a driven gear is in engaged connection below the driving gear; and a funnel is mounted in the bottom of the crushing box. The crushing, screening and mixing integrated device for siniperca chuatsi aquatic feed processing disclosed by the invention can collect raw materials with too great radiuses through a second discharge port and crush the raw materials secondarily, so that the crushing quality is improved; the raw materials are crushed by means of rotation of the crushing blade, are screened through a vibrating box and are mixed through the stirring barrel, so that the raw materials can be crushed, screened and mixed integrally, and the production and processing efficiency is improved.

The invention discloses a crayfish and mandarin fish alternate culture method which includes the steps of preparing of a fishpond, transplanting of water plants, feeding of fish fry, transplanting ofspiral shells, culture management of the fishpond, culture management of mandarin fish, and fishing. According to the ecological habit that crayfish lives in caves in a megathermal period, mandarin fish in the fishpond is cultured in a low density breeding way in the megathermal period. Different varieties are subjected to alternate culture in the same water at alternated seasons, and thus, problems of aging of the fishpond, silt deposition and frequent occurrence of diseases are solved, substance and energy of a fishpond ecological system form a virtuous circle, utilization period and space of unit water is increased, and yield and efficiency increasing is achieved finally.

The invention discloses a method for monitoring Siniperca chuatsi germplasms by virtue of microsatellite genetic marker. The method comprises genome DNA extraction and detection, microsatellite sequence search and analysis, polymorphic microsatellite primer selection and optimization, polymorphic microsatellite detection and monitoring of different geographic siniperca chuatsi populations and hereditary features thereof. Microsatellite loci selection and polymorphic microsatellite marker development and verification are performed on a large number of EST generated by siniperca chuatsi transcriptome sequencing, so that 15 EST-SSR polymorphic microsatellite markers are developed, and different geographic siniperca chuatsi populations and hereditary features thereof can be monitored; the limitations of fuzzy genetic background and less molecular marker amount in existing germplasm detection, selective breeding and germplasm improvement research of siniperca chuatsi can be broken, and a basis is provided for germplasm detection, selective breeding and germplasm improvement of siniperca chuatsi, so that germplasm detection, auxiliary genetic breeding and genomic research processes of siniperca chuatsi molecular markers are promoted.

The invention provides a method for ecological polyculture of crabs, soft-shelled turtles, freshwater shrimps and mandarin fish and relates to the technical field of aquaculture. The method comprises the steps of pond condition and supporting facility and cultivation management. The method has the advantages that production resources are fully utilized, professional devices are not needed, the method is free of culture pollution, a cultivation technology is standard, the feeding is scientific and normative, a polyculture technology is novel, aquaculture quality is greatly improved, and accordingly the earnings are increased.

The invention discloses an artificial feed domestication method for hybrid siniperca chuatsi. The method comprises the following steps of screening out a new hybrid siniperca chuatsi strain which grows fast and is easy to domesticate; hybridizing parent fish of the screened new hybrid siniperca chuatsi strain, and performing artificia propagating to obtain hybridized siniperca chuatsi F1 fry; andstep 3, carrying out full-artificial feed domestication on the obtained hybrid siniperca chuatsi F1 fry easy to domesticate, and keeping the water temperature in a cement pond to be 26 +/-0.5 DEG C, the illumination intensity to be 50lx and the culture density to be 200/m<3> in the domestication management process. According to the method, the new hybrid siniperca chuatsi strain easy to domesticate is bred, the matched artificial feed domestication method for the hybrid siniperca chuatsi is provided, sufficient artificial feed is provided for the siniperca chuatsi industry to breed the siniperca chuatsi fry, and the current situation that the siniperca chuatsi industry is lack of the fry easy to domesticate is changed. The artificial feed domestication method for the hybrid siniperca chuatsi provides optimal environmental factors beneficial to growth and domestication of the new hybrid siniperca chuatsi strain. Siniperca chuatsi artificial compound feed is optimized and developed according to the nutritional requirements in the domestication period, in particular to the matched use of additives and phagostimulants.

The invention discloses siniperca chuatsi raising fodder. The siniperca chuatsi raising fodder comprises, by weight, 20-50 parts of water hyacinth, 40-100 parts of seafood meat powder, 10-30 parts of bran, 15-40 parts of corn flour, 10-30 parts of rice dregs, 5-15 parts of chelating agents, 12-30 parts of herbal powder, 10-20 parts of salt, 8-18 parts of peanut powder, 10-25 parts of lard oil, 5-12 parts of mineral substance additives and 2-8 parts of vitamin additives. The siniperca chuatsi raising fodder is formed by the way that cereal crops and seafood meat powder are used as main ingredients, and the mineral substance additives and the vitamin additives needed for growth of siniperca chuatsi and the herbal powder which can be resistant to diseases and improve immunity are matched to be processed. The manufactured siniperca chuatsi fodder can meet the nutritional requirements of the siniperca chuatsi, be conducive to the growth of the siniperca chuatsi, further enhance the disease resistance of the siniperca chuatsi, improve the raising survival rate, lower cultivation cost and cultivation risks, and be more beneficial to popularization.

The invention discloses a proliferation method of a siniperca chuatsi infectious spleen and kidney necrosis virus (ISKNV). According to the proliferation method, synchronous virus inoculation is adopted, the virus and a siniperca chuatsi brain tissue cell line (CPB) are in a suspended state, and the mutual contact surface area between the virus and the siniperca chuatsi brain tissue cell line is large so that the virus enters cells through more space receptors; and the virus infects the cells while the cells differentiate and proliferate, thus obtaining the high content ISKNV. After the CPB is cultured for 30 hours to 60 hours, the CPB is transferred to 5%-8% v/v of fetal calf serum culture medium, and the ISKNV is synchronously inoculated at the MOI (Multiplicity of Infection) value of 0.85-2.3, thus obtaining a low-cost ISKNV proliferation method. After the CPB is cultured for 20 hours to 40 hours, the CPB is transferred to 8%-10% v/v of fetal calf serum culture medium, and the ISKNV is synchronously inoculated at the MOI (Multiplicity of Infection) value of 30-45, thus obtaining a short ISKNV proliferation method. Cultivation methods can be selected according to existing conditions. The proliferation method provides theoretical basis for production of low-cost viruses.

The invention discloses a method for cultivating Siniperca chuatsi which is characterized by comprising following steps: A. pond processing; B. Siniperca chuatsi fingerling spreading; C. bait discharging; D. daily managing. The invention is aimed at solving the deficiency of the prior art and to provide a method for cultivating Siniperca chuatsi which has high survival rate, convenient feeding, good dispersibility of bait and is easy for Siniperca chuatsi feeding.

The invention discloses a detection primer and probe for rapidly identifying siniperca chuatsi on the basis of a quantitative PCR technology, and a detection kit and detection method adopting the primer and the probe. A detection primer group comprises an upstream primer FP, a downstream primer BP and a probe; and the detection kit comprises a primer solution, a PCR MIX reaction solution, deionized water, a negative control and a positive control. The detection method comprises the following steps: extracting DNA of a sample to be detected, quickly detecting the DNA of the sample to be detected by using a fluorescent quantitative PCR technology, and judging whether the sample to be detected is siniperca chuatsi or not through a real-time amplification curve. The detection primer, the probe, the kit and the method provided by the invention have the advantages of rapidity, sensitivity, specificity, easy operation and the like, and are suitable for popularization and application.

The invention provides a method for household pond culture of siniperca chuatsi and relates to the technical field of transformation of fish product culture techniques. The method is characterized by including the following steps of pond condition determining, pond management, fingerling stocking, bait feeding, water quality management and disease prevention and treatment. The method is reasonable, convenient to operate and reasonable in matching.

The invention discloses a geographical origin tracing identification method for geographical indication mandarin fishes. The method comprises the following steps: firstly preparing to-be-detected mandarin fish muscle solution, determining contents of seven mineral elements, namely Ca, Mg, Ti, V, Fe, Se and Rb, in the to-be-detected mandarin fish solution by utilizing an inductively coupled plasmaemission spectrometer and an inductively coupled plasma source mass spectrometer, substituting a determination result into a mandarin fish Fisher function discrimination model, and determining a geographical origin of to-be-detected mandarin fishes by comparing the size of the mandarin fish Fisher function discrimination model. The method disclosed by the invention firstly builds the mandarin fishFisher function discrimination model for three geographical origins, namely Lianhuanhu in Heilongjiang, Qiupu in Anhui and Echeng in Hubei, accuracy is 100% when the discrimintation model is utilizedfor identifying the geographical origin of the mandarin fishes, discrimination accuracy is high, stability is good, repeatability is high, system error is small, and rapid geographical origin tracingidentification on the geographical indication mandarin fishes from different geographical origins is realized, so that the method disclosed by the invention has better practical guiding significanceand extensive popularization and application values.

The invention discloses a method for detecting veterinary drug residues in fish meat, which comprises the following steps: (1) preparing a sample solution: taking and homogenizing fish meat, adding an acetonitrile aqueous solution containing formic acid, standing for 5-25 minutes, adding homogeneous protons, performing vortex oscillation for 20-40 minutes, centrifuging for 3-7 minutes, taking supernate, enabling the supernate to pass through a reversed-phase solid-phase extraction column, collecting effluent, blow-drying the effluent by N2 gas, adding an initial mobile phase, dissolving and filtering to obtain a test solution; and (2) detecting by adopting an ultra-high performance liquid chromatography-mass spectrometer. According to the method, through a specific sample pretreatment method and an instrument analysis method, veterinary drug residues cover mainstream veterinary drug types such as hormone and macrolide antibiotics and zeranol compounds, and the detection sample range is increased to bulk consumer fish species with complex matrixes such as turbots, mandarin fishes, snakeheaded fishes and grass carps; and the method is simple and rapid, low in cost, high in accuracy and good in stability.