Monoclonal antibody for resisting mandarin fish immune globulin D (IgD) as well as preparation method and application of monoclonal antibody

Abstract

The invention belongs to the technical field of immunology, and particularly relates to an anti-mandarin fish immune globulin D (IgD) monoclonal antibody as well as a preparation method and application thereof. The invention provides a hybridoma cell strain 5C7 capable of secreting an anti-fish IgD monoclonal antibody or an antigen binding fragment thereof for the first time, the hybridoma cell strain 5C7 is preserved in China Center for Type Culture Collection on January 16, 2025, and the preservation number is CCTCC NO: C202550. The anti-mandarin fish IgD monoclonal antibody or the antigen binding fragment thereof can be subjected to specific reaction with mandarin fish secreting type IgD protein and B cell surface film type IgD, can be applied to detection of IgD in a mandarin fish serum sample, and can also be applied to detection of IgD + B cell surface markers.

Description

Technical Field

[0001] The present invention belongs to the technical field of immunology, and particularly relates to a monoclonal antibody against immunoglobulin D (IgD) of mandarin fish, a preparation method thereof, and an application thereof. Background Art

[0002] Immunoglobulin is a glycoprotein produced by B lymphocytes after proliferating and differentiating into plasma cells upon receiving antigen stimulation. As an important component molecule in the process of adaptive immunity, it can specifically bind to corresponding antigen substances. Therefore, the secretion of specific immunoglobulin is an important indicator of the generation of adaptive immunity against pathogens. Immunoglobulin has two existing forms: one is the membrane-bound form as BCR on the surface of B cells, and the other is the secreted form produced and secreted into body fluids by plasmablasts or plasma cells. The structures of the membrane-bound form and the secreted form of the heavy chain are similar, and the difference between the two lies in the number of constant regions, and the C-terminus of the membrane-bound immunoglobulin contains a transmembrane region. The function of the membrane-bound immunoglobulin as a B cell receptor is to recognize soluble antigens, bind to antigens, and conduct a series of signal transduction effects to stimulate the activation and proliferation of B cells. The secreted immunoglobulin exerts the functions of sterilization, bacteriolysis, promoting phagocytosis and agglutination in body fluids. Therefore, antibody-mediated immunity is also called humoral immunity.

[0003] Currently, fish B cells are classified into three major categories according to the molecular types of membrane surface immunoglobulin (mIg): IgM + IgD + B cells (IgM + B cells), IgM - / IgD + B cells (IgD + B cells), IgM - / IgT + (IgZ + ) B cells (IgT / Z + B cells). Fish have a B cell lineage similar to that of mammals. However, since fish lack IgG, IgE, and IgA, they do not have IgG + B cells, IgE + B cells, and IgA + B cells. IgD + B cells are the least well-defined group among the currently identified fish B cells. The current mainstream speculation is still that IgD + B cells participate in the body's immunity, but the functions exercised in immunity are still unclear. IgD +B cells were first discovered in channel catfish and subsequently identified in mucosal-associated lymphoid tissues such as the gills, intestines, and skin of rainbow trout. There are three major classes of immunoglobulins in fish: IgM, IgD, and IgT / Z (for teleosts / zebrafish), which play different functions in humoral immunity. IgD was initially thought to exist only in rodents and primates until Wilson et al. identified IgD in channel catfish. Channel catfish IgD is different from mammalian IgD because it is a chimeric protein containing a Cμ1 domain followed by multiple Cδs. This chimeric structure also exists in Atlantic salmon and other fish. So far, IgD can be detected in the vast majority of teleosts studied. Recent studies have shown that IgD may play an important role in the immune response of fish. However, due to the lack of detection tools for IgD, most studies on IgD have been limited to the gene expression level, and its function in the immune system remains largely unclear. Mandarin fish is an important freshwater aquaculture economic fish in China. With the expansion of the aquaculture scale, the outbreaks of bacterial and viral diseases in mandarin fish are becoming increasingly serious. Therefore, it is urgent to study the immune mechanism of mandarin fish. Preparing monoclonal antibodies against mandarin fish IgD and then exploring the immune response mechanism of mandarin fish B cell subsets has very important practical significance for disease prevention and control, vaccine development, and filling the gap in the study of the evolution of adaptive immunity in teleosts. Summary of the Invention

[0004] The object of the first aspect of the present invention is to provide a hybridoma cell line.

[0005] The object of the second aspect of the present invention is to provide a monoclonal antibody against fish IgD or its antigen-binding fragment.

[0006] The object of the third aspect of the present invention is to provide a method for preparing the monoclonal antibody or its antigen-binding fragment of the second aspect of the present invention.

[0007] The object of the fourth aspect of the present invention is to provide the application of the hybridoma cell line, monoclonal antibody or its antigen-binding fragment of the first and second aspects of the present invention in the preparation of products for detecting and identifying fish IgD.

[0008] The object of the fifth aspect of the present invention is to provide the application of the hybridoma cell line, monoclonal antibody or its antigen-binding fragment of the first and second aspects of the present invention in the preparation of fish vaccines.

[0009] The object of the sixth aspect of the present invention is to provide a kit for detecting fish IgD.

[0010] The object of the seventh aspect of the present invention is to provide a method for constructing the hybridoma cell line of the first aspect of the present invention.

[0011] In order to achieve the above objects of the present invention, the technical solutions adopted by the present invention are:

[0012] In the first aspect of the present invention, a hybridoma cell line 5C7 is provided, and the hybridoma cell line 5C7 was deposited at the China Center for Type Culture Collection on January 16, 2025, with the deposit number CCTCC NO: C202550.

[0013] In the second aspect of the present invention, a monoclonal antibody against fish IgD or an antigen-binding fragment thereof is provided, and the monoclonal antibody or its antigen-binding fragment is produced by the hybridoma cell line 5C7 of the first aspect of the present invention.

[0014] In the third aspect of the present invention, a method for preparing the monoclonal antibody or its antigen-binding fragment of the second aspect of the present invention is provided, including the following steps:

[0015] Culturing the hybridoma cell line 5C7 of the first aspect of the present invention to secrete a monoclonal antibody against IgD or its antigen-binding fragment, and purifying to obtain it.

[0016] In some embodiments of the present invention, the monoclonal antibody against IgD or its antigen-binding fragment is in the culture supernatant of the hybridoma cell line 5C7.

[0017] In the fourth aspect of the present invention, an application of the hybridoma cell line, monoclonal antibody or its antigen-binding fragment of the first and second aspects of the present invention in the preparation of products for detecting and identifying fish IgD is provided.

[0018] In some embodiments of the present invention, the fish includes Siniperca chuatsi.

[0019] In some embodiments of the present invention, the product includes at least one of a reagent and a kit.

[0020] In some embodiments of the present invention, the detection methods used in the kit include enzyme-linked immunosorbent assay, Western blotting, indirect immunofluorescence assay, flow cytometry, and protein liquid chip.

[0021] In the fifth aspect of the present invention, an application of the hybridoma cell line, monoclonal antibody or its antigen-binding fragment of the first and second aspects of the present invention in the preparation of fish vaccines is provided.

[0022] In the sixth aspect of the present invention, a kit for detecting fish IgD is provided, including the hybridoma cell line 5C7 of the first aspect of the present invention and the monoclonal antibody or its antigen-binding fragment of the second aspect of the present invention

[0023] In some embodiments of the present invention, the fish includes Siniperca chuatsi.

[0024] In some embodiments of the present invention, the detection methods used in the kit include enzyme-linked immunosorbent assay, Western blotting, indirect immunofluorescence assay, flow cytometry, and protein liquid chip.

[0025] The seventh aspect of the present invention provides a method for constructing a hybridoma cell line according to the first aspect of the present invention, comprising the following steps:

[0026] Recombinant protein of the C region of mandarin fish IgD heavy chain is expressed by prokaryotic expression;

[0027] The recombinantly expressed protein is used as an antigen for immunization;

[0028] After immunization of the animal, cell fusion, screening and cloning are carried out to obtain the hybridoma cell line.

[0029] In some embodiments of the present invention, the screening methods are indirect enzyme-linked immunosorbent assay, immunoblotting and flow cytometry.

[0030] The beneficial effects of the present invention are:

[0031] The present invention provides for the first time a hybridoma cell line 5C7 that can secrete anti-fish IgD monoclonal antibody or its antigen-binding fragment, which was deposited at the China Center for Type Culture Collection on January 16, 2025, with the deposit number CCTCC NO: C202550.

[0032] The anti-mandarin fish IgD monoclonal antibody or its antigen-binding fragment described in the present invention can specifically react with mandarin fish secreted IgD protein and B cell surface membrane IgD, and can be applied to the detection of IgD in mandarin fish serum samples, and can also be used to detect IgD + B cell surface markers. The present invention combines three immunological detection methods of indirect enzyme-linked immunosorbent assay, immunoblotting and flow cytometry. Mutually corroborate the true existence of the specific binding of the monoclonal antibody described in the present invention to mandarin fish IgD, and at the same time more intuitively demonstrate the specific binding between the monoclonal antibody described in the present invention and mandarin fish IgD by various means. Description of the Drawings

[0033] Figure 1 For the expression identification of recombinant protein of the C region of mandarin fish IgD heavy chain, where the M lane represents the molecular weight standard protein.

[0034] Figure 2 For the analysis of the specific binding of monoclonal antibody to IgD in mandarin fish serum by indirect enzyme-linked immunosorbent assay; where 1 represents the OD value of the binding reaction between SP2 / 0 culture supernatant and IgD in mandarin fish serum, that is, the negative control; 2 represents the OD value of the binding reaction between the monoclonal antibody and IgD in mandarin fish serum.

[0035] Figure 3 For analyzing the specific binding of monoclonal antibody to IgD heavy chain and recombinant IgD in mandarin fish serum by Western blotting; where the M lane represents the molecular weight standard protein.

[0036] Figure 4 For analyzing the specific binding reaction of monoclonal antibody to mandarin fish lymphocytes by flow cytometry, where P1 represents the proportion of IgD+ cells; 1 represents the histogram of the proportion of IgD in mandarin fish lymphocytes when the culture supernatant of SP2 / 0 is used as the primary antibody, that is, the negative control; 2 represents the histogram of the proportion of IgD in mandarin fish lymphocytes when the monoclonal antibody is used as the primary antibody. + histogram of the proportion of cells; + histogram of the proportion of IgD cells in mandarin fish lymphocytes. Specific implementation mode

[0037] The following will clearly and completely describe the concept and technical effects generated by the present invention in combination with the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative labor all fall within the scope of protection of the present invention.

[0038] Example 1

[0039] This example provides a hybridoma cell line capable of secreting anti-mandarin fish IgD heavy chain, and the preparation method includes the following steps:

[0040] 1. Recombinant expression of mandarin fish IgD heavy chain protein

[0041] 1) According to the published mandarin fish IgD heavy chain-encoding gene sequence (GeneBank: XM_044180524.1), Tsingke Biotech was commissioned to synthesize the heavy chain C region, and the specific sequence is: ACAGCTCCATCAGTGGAGATCAGGAGATCGCTCCCAGATTTGCTGAAGGGAAACAGTGCTGTGCTGGAGTGTGACATCACACAACTCTCCTCCAGTGACCTCTACGTCACCTTTCAGGCCAACAGTGTTGATATTTCTGACAAACAGTATGTTGATCTCCCTGAAGCCCCAGGCCTCCATTCGGTCAGTAGACGCTTCACTGTCCCTCCAAGTCACTGGAAGAAAGACACAAGTTTCACCTGCAAAGTGAATCAAGGCTTCTCCAGCAACTTTGAGTCAAACTCTACTGGCAAAATTTTTGTGGACCCATCAGTGGAGCTCCTTCTGGTCCCCAGTAAAGAGTCAGGACCACAGAGGCTCGTTTGCTCTGGATGGGGCTTCGACCCTCAAATTAAATGGTTTTCTGAGTCTCAGCAAAGATCTCCATCAACTAATGACATCAGCATGGGTGCAGATGGACGTGTGGCAGTAACCAGTCAACTTCATATCCCCCAAACAGAGTGGAAAACAGGGAAGGGCTTCACTTGCAAAGTGTCTGACAAGTCTCTGAACAAAAGTGTCAGAAGGGACATCAGCCTCTGCTCAGCTTATTCAAGCGCC (SEQ ID NO: 1).

[0042] 2) The gene sequence was ligated to the MCS region of plasmid pGEX-4T-1 to construct plasmid pGEX-4T-1-IgD.

[0043] 3) Take 20 μg of the recombinant plasmid pGEX-4T-1-IgD and add it to the competent Escherichia coli BL21(DE3) that has been melted on ice. Let it stand on ice for 30 min, heat shock in a 42 °C water bath for 45 s, quickly put it back on ice and let it stand for 2 min. Add 700 μL of antibiotic-free LB medium, recover at 37 °C for 1 h, centrifuge at 5000 rpm for 1 min, retain about 100 μL of the supernatant and gently pipette to resuspend the bacterial pellet, and spread it on the LB solid medium containing ampicillin resistance. After culturing overnight at 37 °C, pick a single colony and detect the insertion of the target gene by PCR amplification.

[0044] 4) Inoculate the positive cloned bacteria into LB liquid medium with ampicillin resistance and culture them overnight on a shaker at 37°C. The next day, dilute the cultured bacterial solution overnight at a volume ratio of 1:100 and culture it at 37°C until the OD600 of the bacterial solution reaches 0.4 - 0.6. Then add isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.2 mM and continue to culture at 16°C for 15 - 18 h. After that, centrifuge at 5000 rpm to collect the bacterial cells, add high-salt lysis buffer, and ultrasonically disrupt for 15 min. Then centrifuge at 12000 rpm for 15 min, take the supernatant, and purify the recombinant protein using GST fusion protein purification magnetic beads. The purified recombinant protein was detected by SDS-PAGE for the purification situation.

[0045] The results showed that the purified target recombinant protein band was relatively single, with a molecular weight of about 55 kDa, which was consistent with the expected size ( Figure 1 ).

[0046] 2. Preparation of immunized mice

[0047] 1) Select 6 - 8-week-old female Balb / c mice and maintain the breeding temperature at 21 - 27°C with a 12 / 12 h light / dark cycle provided daily.

[0048] 2) Dilute the recombinant mandarin fish IgD with physiological saline to 0.4 mg / mL, take 50 μL, and quickly mix it with the water-soluble adjuvant QuickAntibody-Mouse 5W (Biodragon, KX0210041) at a volume ratio of 1:1.

[0049] 3) Immunize the mice by intramuscular injection into the hind leg calf muscle, with 100 μL injected into each mouse, containing 20 μg of antigen. Strengthen the immunization with 1 injection in the same way 21 days after the first immunization.

[0050] 3. Cell fusion

[0051] 1) Three days before cell fusion, boost the immunization with antigen without adjuvant, with an immunization dose of 100 μL and an antigen content of 20 μg.

[0052] 2) Sacrifice the mice by cervical dislocation, soak them in 75% alcohol for 5 min, then aseptically isolate the spleens of the mice, pass them through a 100-mesh cell sieve, and resuspend them in DMEM incomplete medium to form a single-cell suspension of the spleen.

[0053] 3) Take 2×10 8 SP2 / 0 cells in the exponential growth phase. After blowing down the cells with DMEM incomplete medium, centrifuge at 1000 rpm for 10 min. Discard the supernatant and add 5 mL of DMEM incomplete medium to resuspend them into an SP2 / 0 cell suspension.

[0054] 4) Mix the above-mentioned single-cell suspension of spleen and SP2 / 0 cell suspension in a 50 mL centrifuge tube, centrifuge at 1000 rpm for 10 min, and discard the supernatant.

[0055] 5) Add 700 μL of PEG1500, fuse at 37 °C for 3 min, then add 500 μL of DMEM medium within 1 min, and incubate at 37 °C for 3 min. Subsequently, add 10 mL of DMEM medium within 2 - 3 min and incubate at 37 °C for 10 min.

[0056] 6) Centrifuge at 1000 rpm for 10 min, resuspend the cells with HAT-containing medium after removing the supernatant, and inoculate the cells into 10 96-well plates.

[0057] 7) After 10 days, change to HT medium for continuous culture.

[0058] 4. Screening

[0059] 1) Screening can be carried out when the fused hybridoma cell population grows to 1 / 3 of the well plate area.

[0060] 2) Dilute the recombinant IgD protein to 2 μg / mL with NaCO 3 -NaHCO 3 at 100 μL / well and coat at 37 °C for 2 h.

[0061] 3) Wash three times with PBST.

[0062] 4) Block with 1% skim milk powder at 37 °C for 1 h.

[0063] 5) Wash three times with PBST.

[0064] 6) Add the hybridoma cell culture supernatant into the wells, and the control group is the SP2 / 0 cell culture supernatant. Add 100 μL / well and incubate at 37 °C for 1 h.

[0065] 7) Wash three times with PBST.

[0066] 8) Dilute HRP goat anti-mouse IgG (H+L) at 1:5000, add 100 μL / well and incubate at 37 °C for 1 h.

[0067] 9) Wash three times with PBST.

[0068] 10) Add 100 μL of single-component TMB substrate solution and react for 5 min.

[0069] 11) Add 100 μL of termination solution (2M H 2 SO 4) Measure the OD value at a wavelength of 450 nm using an enzyme - linked immunosorbent assay (ELISA) reader. Calculate the ratio of the optical density of each experimental well to that of the negative control (P / N). When P / N ≥ 2.1, it is determined as positive.

[0070] After screening, the hybridoma cell numbered 5C7 was strongly positive and met the screening criteria.

[0071] 5. Cloning

[0072] Clone the fused cells in the positive wells, which specifically includes the following steps:

[0073] 1) Count the cells in the positive wells using a hemocytometer. Take out 50 hybridoma cells and inoculate them into a 96 - well plate, 100 μL per well.

[0074] 2) Incubate in a cell culture incubator at 37 °C with 5% CO 2 Observe the cell growth status after 3 days of culture. Mark the wells containing the growth of single hybridoma cell clusters.

[0075] 3) When the cells in the marked wells grow to 1 / 3 of the well plate area, detect the culture supernatant of hybridoma cells in each well by indirect enzyme - linked immunosorbent assay. Clone the obtained positive cells again by the above method to ensure the formation of monoclonal cells.

[0076] Finally, a hybridoma cell line 5C7 secreting anti - mandarin fish IgD monoclonal antibody was obtained. This hybridoma cell line was deposited at the China Center for Type Culture Collection (Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on January 16, 2025, and the deposit number is CCTCC NO: C202550.

[0077] Example 2 Identification of anti - mandarin fish IgD monoclonal antibody by indirect enzyme - linked immunosorbent assay

[0078] This example provides an identification of the monoclonal antibody described in Example 1 by indirect enzyme - linked immunosorbent assay, which includes the following steps:

[0079] 1) Dilute mandarin fish serum 50 - fold with NaCO 3 -NaHCO 3 at pH = 9.6, 100 μL per well, and coat at 37 °C for 2 h.

[0080] 2) Wash three times with PBST.

[0081] 3) Block with 1% skim milk powder at 37 °C for 1 h.

[0082] 4) Add 100 μL of the culture supernatant of the hybridoma cells screened and cloned in Example 1. Add the culture supernatant of SP2 / 0 medium as a control in the control group, and incubate at 37 °C for 1 h.

[0083] 5) Wash three times with PBST.

[0084] 6) HRP goat anti-mouse IgG (H+L), diluted 1:5000, 100 μL / well, incubated at 37 °C for 1 h.

[0085] 7) Wash three times with PBST.

[0086] 8) Add 100 μL of single-component TMB substrate solution and react for 5 min.

[0087] 9) Wash three times with PBST.

[0088] 10) Add 100 μL of single-component TMB substrate solution and react for 5 min.

[0089] 11) Add 100 μL of termination solution (2M H 2 SO 4 ), and measure the OD value with an enzyme-linked immunosorbent assay reader at a wavelength of 450 nm.

[0090] Results: The absorbance value of the positive well was 0.991; the absorbance value of the control well was 0.065( Figure 2 ). This result proves that the monoclonal antibody of the present invention can specifically bind to the secreted IgD in mandarin fish serum.

[0091] Example 3 Identification of Anti-Mandarin Fish IgD Monoclonal Antibody by Immunoblotting

[0092] This example provides an identification of the monoclonal antibody described in Example 1 by immunoblotting, which includes the following steps:

[0093] 1) Add 80 μL of mandarin fish serum or 80 μL of recombinant IgD protein to 20 μL of 5× Loading buffer (Affinibody, AIWB-0025), and heat in boiling water for 10 min.

[0094] 2) Dilute the treated sample 50-fold with 1× Loading buffer and add it to the loading wells of the FastPAGE Precast GelFastPAGE (TSINGKE, TSP024-12) protein precast gel. Electrophoresis was carried out at a constant voltage of 160 V for 45 min.

[0095] 3) After electrophoresis, use the ice-free rapid membrane transfer buffer (Servicebio, G2028-1L), and transfer the protein on the gel to the PVDF membrane at a constant current of 400 mA for 30 min.

[0096] 4) Place the membrane in the MinuteBlock rapid low-background blocking solution (Affinibody, AIWB-004) and block for 10 min.

[0097] 5) Wash the membrane three times with PBST for 5 min each time.

[0098] 6) Dilute the supernatant of the hybridoma cell culture medium screened and cloned in Example 1 1000-fold with PBST, place the membrane therein, and incubate overnight at 4 °C.

[0099] 7) Wash the membrane three times with PBST for 5 min each time.

[0100] 8) Dilute HRP goat anti-mouse IgG (H+L) 1:5000 and incubate at room temperature for 1 h.

[0101] 9) Wash the membrane three times with PBST for 5 min each time.

[0102] 10) Develop the color according to the instructions of the High-sig ECL Western Blotting Substrate kit (Tanon, 180-5001).

[0103] Result: The monoclonal antibody of the present invention specifically reacts with the heavy chain of secreted IgD and recombinant IgD in mandarin fish serum ( Figure 3 ).

[0104] Example 4 Flow cytometry identification of monoclonal antibody against mandarin fish IgD

[0105] This example provides a flow cytometry identification of the monoclonal antibody described in Example 1, which includes the following steps:

[0106] 1) Prepare Percoll separation solution (4 mL of 52% Percoll + 4 mL of 34% Percoll) in a 15 mL centrifuge tube.

[0107] 2) Take the spleen of a healthy mandarin fish, wash it and cut it into small pieces, pass through a 100-mesh cell sieve, centrifuge at 1000 rpm for 10 min, resuspend the cell pellet with PBS and add it to the upper layer of the Percoll separation solution, and centrifuge at 500 g for 30 min.

[0108] 3) Take the white cell layer between 52% Percoll and 34% Percoll, and obtain mandarin fish lymphocytes after washing with PBS.

[0109] 4) After counting the cells, aliquot them into EP tubes, with each sample containing 5×10 6 lymphocytes.

[0110] 5) Use the supernatant of the hybridoma cell culture medium screened and cloned in Example 1 as the primary antibody, add it to the lymphocytes and incubate at room temperature for 30 min, and add the SP2 / 0 cell culture supernatant to the control wells.

[0111] 6) Centrifuge the completed primary antibody system at 1000 rpm for 5 min, discard the supernatant to obtain cell pellet, and then wash the obtained cell pellet three times with FACS Buffer (PBS + 2% FBS).

[0112] 7) Add Goat Anti-Mouse IgG H&L (AlexaFluor 488) fluorescent secondary antibody and incubate in the dark on ice for 30 min.

[0113] 8) Wash three times with FACS Buffer, resuspend the cells with 500 μL FACS Buffer and analyze by flow cytometry.

[0114] Results: The monoclonal antibody of the present invention specifically reacts with IgD expressed on the membrane of mandarin fish lymphocytes ( Figure 4 ).

Claims

1. A hybridoma cell line 5C7, characterized in that: The hybridoma cell line 5C7 was deposited in the China Center for Type Culture Collection on January 16, 2025, with the deposit number being CCTCC NO: C202550.

2. A monoclonal antibody or antigen-binding fragment thereof against fish IgD, characterized in that: The cloned antibody or antigen-binding fragment thereof is produced by the hybridoma cell line 5C7 according to claim 1.

3. The method for preparing the monoclonal antibody or antigen-binding fragment thereof according to claim 2, comprising the following steps: The hybridoma cell line 5C7 according to claim 1 is cultured to secrete anti-IgD cloned antibodies or antigen-binding fragments thereof, and purified to obtain.

4. Use of the hybridoma cell line 5C7 according to claim 1 or the monoclonal antibody or antigen-binding fragment thereof according to claim 2 in the preparation of a product for detecting and identifying fish IgD.

5. Use of the hybridoma cell line 5C7 according to claim 1 or the monoclonal antibody or antigen-binding fragment thereof according to claim 2 in the preparation of fish vaccines.

6. The use according to claim 4 or 5, characterized in that: The fish includes mandarin fish.

7. The use according to claim 4, characterized in that: The product includes at least one of a reagent and a kit.

8. The use according to claim 7, characterized in that: The detection methods adopted by the kit include enzyme-linked immunosorbent assay, protein blotting, indirect immunofluorescence assay, flow cytometry, and protein liquid phase chip.

9. A kit for detecting fish IgD, characterized in that: The kit comprises the hybridoma cell line 5C7 according to claim 1, or the monoclonal antibody or antigen-binding fragment thereof according to claim 2.

10. The kit according to claim 9, characterized in that: The kit also includes a reaction buffer.

Images